Regulon of YhgD in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK0664
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Regulog:	YhgD - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 6.5 Sequence: TGACCAAATTGTTCATTTAGTCA Locus tag: GK0664 Name: yhgD Funciton: Transcriptional regulator, TetR family
	GK0664	yhgD	Transcriptional regulator, TetR family
Position: 11 Score: 6.1 Sequence: TGACCATACGGACAATTTGGTCA Locus tag: GK0665 Name: yhgE Funciton: Predicted membrane protein
	GK0665	yhgE	Predicted membrane protein
Position: -272 Score: 6.2 Sequence: TGACCGAAACGTCCATTTGGTCA Position: -49 Score: 6.4 Sequence: TGACTAAATGGACAAATCGGTCA Locus tag: GK0328 Name: yhgE Funciton: Predicted membrane protein
	GK0328	yhgE	Predicted membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD