Regulon of YhgD in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_010380
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Regulog:	YhgD - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.8 Sequence: TGACCGTTTTGTCAAATGAGTCA Locus tag: RBAM_010390 Name: yhgE Funciton: Predicted membrane protein
	RBAM_010390	yhgE	Predicted membrane protein
Position: -42 Score: 5.8 Sequence: TGACTAAAACGTTCAAACGGTCA Locus tag: RBAM_010380 Name: yhgD Funciton: Transcriptional regulator, TetR family
	RBAM_010380	yhgD	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD