Regulog LexA - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By trascription factor - LexA
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
| Genome | Genes | Operons |
|---|---|---|
| Ralstonia solanacearum GMI1000 | 8 | 5 |
| Ralstonia pickettii 12J | 8 | 5 |
| Ralstonia metallidurans CH34 | 13 | 10 |
| Ralstonia eutropha JMP134 | 12 | 9 |
| Ralstonia eutropha H16 | 13 | 10 |
| Cupriavidus taiwanensis | 16 | 11 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| H16_B2553 |
|
|
*
Ralstonia metallidurans CH34 Site: position = -42 score = 6.26715 sequence = CACTGTATATTTATACAGTG Gene: Rmet_5910: Conserved hypothetical protein |
*
Ralstonia eutropha JMP134 Site: position = -51 score = 6.04477 sequence = GACTGTATATTCGTACAGTA Gene: Reut_B5317: Conserved hypothetical protein |
*
Ralstonia eutropha H16 Site: position = -51 score = 6.04477 sequence = GACTGTATATTCGTACAGTA Gene: H16_B2553: Conserved hypothetical protein |
*
Cupriavidus taiwanensis Site: position = -42 score = 6.04477 sequence = GACTGTATATTCGTACAGTA Gene: RALTA_B2284: Conserved hypothetical protein |
Conserved hypothetical protein |
| CRON 2. | |||||||
| recA |
*
Ralstonia solanacearum GMI1000 Site: position = -180 score = 5.45985 sequence = CACTGGTTTTTTATACAGTA Gene: RSc0551: Recombinase A |
*
Ralstonia pickettii 12J Site: position = -172 score = 5.45985 sequence = CACTGGTTTTTTATACAGTA Gene: Rpic_0471: Recombinase A |
*
Ralstonia metallidurans CH34 Site: position = -171 score = 6.06005 sequence = TACTGTTTTTTTATACAGTA Gene: Rmet_0466: Recombinase A |
*
Ralstonia eutropha JMP134 Site: position = -194 score = 6.06005 sequence = TACTGTTTTTTTATACAGTA Gene: Reut_A0527: Recombinase A |
*
Ralstonia eutropha H16 Site: position = -159 score = 6.06005 sequence = TACTGTTTTTTTATACAGTA Gene: H16_A0544: Recombinase A |
*
Cupriavidus taiwanensis Site: position = -159 score = 6.06005 sequence = TACTGTTTTTTTATACAGTA Gene: RALTA_A0499: Recombinase A |
Recombinase A |
| recX |
Gene: RSc0552: Regulatory protein RecX |
Gene: Rpic_0472: Regulatory protein RecX |
Gene: Rmet_0467: Regulatory protein RecX |
Gene: Reut_A0528: Regulatory protein RecX |
Gene: H16_A0545: Regulatory protein RecX |
Gene: RALTA_A0500: Regulatory protein RecX |
Regulatory protein RecX |
| CRON 3. | |||||||
| lexA |
*
Ralstonia solanacearum GMI1000 Site: position = -25 score = 5.44599 sequence = ACCTGTTCAAATATACAGTG Site: position = -44 score = 5.2999 sequence = CACTGTATAAAATCACAGCA Gene: RSc1304: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Ralstonia pickettii 12J Site: position = -25 score = 5.44599 sequence = ACCTGTTCAAATATACAGTG Site: position = -44 score = 5.2999 sequence = CACTGTATAAAATCACAGCA Gene: Rpic_1179: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Ralstonia metallidurans CH34 Site: position = -43 score = 6.03503 sequence = TACTGTTTAAACATACAGTG Site: position = -63 score = 5.4495 sequence = TACTGTATAAAATCACAGCA Gene: Rmet_1981: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Ralstonia eutropha JMP134 Site: position = -74 score = 6.03503 sequence = TACTGTTTAAACATACAGTG Site: position = -95 score = 5.00222 sequence = TACTGTATAAAATCACAGGC Gene: Reut_A2008: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Ralstonia eutropha H16 Site: position = -101 score = 6.03503 sequence = TACTGTTTAAACATACAGTG Site: position = -121 score = 5.4495 sequence = TACTGTATAAAATCACAGCA Gene: H16_A2281: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Cupriavidus taiwanensis Site: position = -98 score = 6.03503 sequence = TACTGTTTAAACATACAGTG Site: position = -118 score = 5.4495 sequence = TACTGTATAAAATCACAGCA Gene: RALTA_A1825: SOS-response repressor and protease LexA (EC 3.4.21.88) |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
| CRON 4. | |||||||
| uvrD |
*
Ralstonia solanacearum GMI1000 Site: position = -39 score = 6.04662 sequence = TGCTGTATATTTATACAGTT Gene: RS05321: ATP-dependent DNA helicase II |
*
Ralstonia pickettii 12J Site: position = -40 score = 5.93239 sequence = TGCTGTATATTCATACAGTT Gene: Rpic_4129: ATP-dependent DNA helicase II |
*
Ralstonia metallidurans CH34 Site: position = -66 score = 5.60616 sequence = GGCTGTATGGATATACAGTG Gene: Rmet_0232: ATP-dependent DNA helicase II |
*
Ralstonia eutropha JMP134 Site: position = -6 score = 5.67101 sequence = GCCTGTATGGATATACAGTT Gene: Reut_A0283: ATP-dependent DNA helicase II |
*
Ralstonia eutropha H16 Site: position = -68 score = 5.69864 sequence = CCCTGTATGGATATACAGTT Gene: H16_A0305: ATP-dependent DNA helicase II |
*
Cupriavidus taiwanensis Site: position = -62 score = 5.58274 sequence = GGCTGTATGGATATACAGTT Gene: RALTA_A0247: ATP-dependent DNA helicase II |
ATP-dependent DNA helicase II |
| CRON 5. | |||||||
| H16_A1352 |
|
|
*
Ralstonia metallidurans CH34 Site: position = -70 score = 6.16585 sequence = TACTGTACATTCATACAGTA Gene: Rmet_1177: Conserved hypothetical protein |
*
Ralstonia eutropha JMP134 Site: position = 125 score = 5.89529 sequence = TACTGTACATCCATACAGTA Gene: Reut_A1285: Conserved hypothetical protein |
*
Ralstonia eutropha H16 Site: position = 41 score = 5.89529 sequence = TACTGTACATCCATACAGTA Gene: H16_A1352: Conserved hypothetical protein |
*
Cupriavidus taiwanensis Site: position = -33 score = 5.89529 sequence = TACTGTACATCCATACAGTA Gene: RALTA_A1272: Conserved hypothetical protein |
Conserved hypothetical protein |
| CRON 6. | |||||||
| PF06733 |
|
|
|
*
Ralstonia eutropha JMP134 Site: position = -44 score = 6.10187 sequence = GACTGTATATTCATACAGTT Gene: Reut_B5827: DinG family ATP-dependent helicase CPE1197 |
*
Ralstonia eutropha H16 Site: position = -103 score = 6.27911 sequence = TACTGTATATTCATACAGTT Gene: H16_B1265: DinG family ATP-dependent helicase CPE1197 |
*
Cupriavidus taiwanensis Site: position = -88 score = 6.18192 sequence = TACTGTATATTTGTACAGTT Gene: RALTA_B1170: DinG family ATP-dependent helicase CPE1197 |
DinG family ATP-dependent helicase CPE1197 |
| CRON 7. | |||||||
| dinD |
|
|
|
|
|
*
Cupriavidus taiwanensis Site: position = -68 score = 6.28382 sequence = CACTGTATATTCATACAGTA Gene: RALTA_A3210: DNA-damage-inducible protein, part of SOS response |
DNA-damage-inducible protein, part of SOS response |
| CRON 8. | |||||||
| dinB |
|
|
*
Ralstonia metallidurans CH34 Site: position = -40 score = 6.11225 sequence = TACTGTACGTTTATACAGTA Gene: Rmet_3545: DNA polymerase IV (EC 2.7.7.7) |
|
|
|
DNA polymerase IV (EC 2.7.7.7) |
| CRON 9. | |||||||
| imuA |
*
Ralstonia solanacearum GMI1000 Site: position = -159 score = 6.16285 sequence = TACTGTATATCCATACAGTA Gene: RS01909: Predicted RecA/RadA recombinase |
*
Ralstonia pickettii 12J Site: position = -44 score = 6.43342 sequence = TACTGTATATTCATACAGTA Gene: Rpic_4490: Predicted RecA/RadA recombinase |
*
Ralstonia metallidurans CH34 Site: position = -72 score = 6.3808 sequence = TACTGTATAAACATACAGTA Gene: Rmet_4128: Predicted RecA/RadA recombinase |
*
Ralstonia eutropha JMP134 Site: position = 91 score = 6.34071 sequence = TACTGTATAAATATACAGTT Gene: Reut_B4525: Predicted RecA/RadA recombinase |
*
Ralstonia eutropha H16 Site: position = -72 score = 6.34071 sequence = TACTGTATAAATATACAGTT Gene: H16_B1060: Predicted RecA/RadA recombinase |
*2
Cupriavidus taiwanensis Site: position = -72 score = 6.34071 sequence = TACTGTATAAATATACAGTT Gene: RALTA_B0872: Predicted RecA/RadA recombinase Site: position = -41 score = 6.31778 sequence = AACTGTATAAATATACAGTA Gene: pRALTA_0101: Predicted RecA/RadA recombinase |
Predicted RecA/RadA recombinase |
| imuB |
Gene: RS01908: DNA polymerase-like protein PA0670 |
Gene: Rpic_4489: DNA polymerase-like protein PA0670 |
Gene: Rmet_4129: DNA polymerase-like protein PA0670 |
Gene: Reut_B4524: DNA polymerase-like protein PA0670 |
Gene: H16_B1061: DNA polymerase-like protein PA0670 |
2
Cupriavidus taiwanensis Gene: RALTA_B0873: DNA polymerase-like protein PA0670 Gene: pRALTA_0100: DNA polymerase-like protein PA0670 |
DNA polymerase-like protein PA0670 |
| dnaE2 |
Gene: RSp0800: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. |
Gene: Rpic_4488: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. |
Gene: Rmet_4130: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. |
Gene: Reut_B4523: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. |
Gene: H16_B1062: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. |
2
Cupriavidus taiwanensis Gene: RALTA_B0874: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. Gene: pRALTA_0099: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. |
macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif. |
| CRON 10. | |||||||
| PF04055 |
Gene: RS04486: DNA repair photolyase |
Gene: Rpic_0799: DNA repair photolyase |
*
Ralstonia metallidurans CH34 Site: position = -48 score = 6.54765 sequence = TACTGTATATTTATACAGTA Gene: Rmet_0742: DNA repair photolyase |
Gene: Reut_A2545: DNA repair photolyase |
*
Ralstonia eutropha H16 Site: position = -44 score = 6.47447 sequence = TACTGTATATATATACAGTG Gene: H16_A0887: DNA repair photolyase |
Gene: RALTA_A0800: DNA repair photolyase |
DNA repair photolyase |
| CRON 11. | |||||||
| BPSS1334 |
*
Ralstonia solanacearum GMI1000 Site: position = -29 score = 5.22255 sequence = CAGTGTACGTATATACAGTC Site: position = -44 score = 5.86716 sequence = GCCTGTATATATTTACAGTG Gene: RS00884: Conserved hypothetical protein |
*
Ralstonia pickettii 12J Site: position = -26 score = 5.26919 sequence = AACTGTGAATTTATACAGTG Site: position = -45 score = 5.97717 sequence = AACTGTATATATTCACAGTA Gene: Rpic_4716: Conserved hypothetical protein |
*
Ralstonia metallidurans CH34 Site: position = -43 score = 5.23639 sequence = AACTGTATGGATGAACAGTC Site: position = -62 score = 6.28414 sequence = CACTGTATATATTTACAGTA Gene: Rmet_1637: Conserved hypothetical protein |
*
Ralstonia eutropha JMP134 Site: position = -31 score = 5.34461 sequence = ACCTGTATGGATAAACAGTG Site: position = -50 score = 6.43375 sequence = TACTGTATATATTTACAGTA Gene: Reut_B3817: Conserved hypothetical protein |
*
Ralstonia eutropha H16 Site: position = -32 score = 5.26409 sequence = ACCTGTATGGATGAACAGTA Site: position = -51 score = 6.43375 sequence = TACTGTATATATTTACAGTA Gene: H16_B0943: Conserved hypothetical protein |
*
Cupriavidus taiwanensis Site: position = -48 score = 5.1332 sequence = ACCTGTATGGATGAACAGTG Site: position = -67 score = 6.43375 sequence = TACTGTATATATTTACAGTA Gene: RALTA_B0767: Conserved hypothetical protein |
Conserved hypothetical protein |
| CRON 12. | |||||||
| uvrA |
Gene: RSp0994: Excinuclease ABC subunit A |
Gene: Rpic_4441: Excinuclease ABC subunit A |
*
Ralstonia metallidurans CH34 Site: position = -150 score = 6.11599 sequence = CACTGTATGTTCATACAGTA Gene: Rmet_4549: Excinuclease ABC subunit A |
*
Ralstonia eutropha JMP134 Site: position = -160 score = 5.55769 sequence = CACTGTACGGATATACAGTC Gene: Reut_B4240: Excinuclease ABC subunit A |
*
Ralstonia eutropha H16 Site: position = -72 score = 5.74147 sequence = GACTGTATGGATGTACAGTG Gene: H16_B1571: Excinuclease ABC subunit A |
*
Cupriavidus taiwanensis Site: position = -71 score = 5.74147 sequence = GACTGTATGGATGTACAGTG Gene: RALTA_B1379: Excinuclease ABC subunit A |
Excinuclease ABC subunit A |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |