Regulon of LexA in Ralstonia pickettii 12J

Properties
Regulator type:	Transcription factor
TF locus tag:	Rpic_1179
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Ralstonia
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.4 Sequence: TACTGTATATTCATACAGTA Locus tag: Rpic_4490 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Rpic_4489 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Rpic_4488 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
	Rpic_4490	imuA	Predicted RecA/RadA recombinase
	Rpic_4489	imuB	DNA polymerase-like protein PA0670
	Rpic_4488	dnaE2	macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
Position: -172 Score: 5.5 Sequence: CACTGGTTTTTTATACAGTA Locus tag: Rpic_0471 Name: recA Funciton: Recombinase A Locus tag: Rpic_0472 Name: recX Funciton: Regulatory protein RecX
	Rpic_0471	recA	Recombinase A
	Rpic_0472	recX	Regulatory protein RecX
Position: -44 Score: 5.3 Sequence: CACTGTATAAAATCACAGCA Position: -25 Score: 5.4 Sequence: ACCTGTTCAAATATACAGTG Locus tag: Rpic_1179 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Rpic_1179	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -45 Score: 6 Sequence: AACTGTATATATTCACAGTA Position: -26 Score: 5.3 Sequence: AACTGTGAATTTATACAGTG Locus tag: Rpic_4716 Name: BPSS1334 Funciton: Conserved hypothetical protein
	Rpic_4716	BPSS1334	Conserved hypothetical protein
Position: -40 Score: 5.9 Sequence: TGCTGTATATTCATACAGTT Locus tag: Rpic_4129 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Rpic_4129	uvrD	ATP-dependent DNA helicase II

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD