Regulon of LexA in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_1981
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Ralstonia
Statistics of regulated genes:
- Genes	13
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -171 Score: 6.1 Sequence: TACTGTTTTTTTATACAGTA Locus tag: Rmet_0466 Name: recA Funciton: Recombinase A Locus tag: Rmet_0467 Name: recX Funciton: Regulatory protein RecX
	Rmet_0466	recA	Recombinase A
	Rmet_0467	recX	Regulatory protein RecX
Position: -63 Score: 5.4 Sequence: TACTGTATAAAATCACAGCA Position: -43 Score: 6 Sequence: TACTGTTTAAACATACAGTG Locus tag: Rmet_1981 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Rmet_1981	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -70 Score: 6.2 Sequence: TACTGTACATTCATACAGTA Locus tag: Rmet_1177 Name: H16_A1352 Funciton: Conserved hypothetical protein
	Rmet_1177	H16_A1352	Conserved hypothetical protein
Position: -40 Score: 6.1 Sequence: TACTGTACGTTTATACAGTA Locus tag: Rmet_3545 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Rmet_3545	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -72 Score: 6.4 Sequence: TACTGTATAAACATACAGTA Locus tag: Rmet_4128 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Rmet_4129 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Rmet_4130 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
	Rmet_4128	imuA	Predicted RecA/RadA recombinase
	Rmet_4129	imuB	DNA polymerase-like protein PA0670
	Rmet_4130	dnaE2	macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
Position: -62 Score: 6.3 Sequence: CACTGTATATATTTACAGTA Position: -43 Score: 5.2 Sequence: AACTGTATGGATGAACAGTC Locus tag: Rmet_1637 Name: BPSS1334 Funciton: Conserved hypothetical protein
	Rmet_1637	BPSS1334	Conserved hypothetical protein
Position: -66 Score: 5.6 Sequence: GGCTGTATGGATATACAGTG Locus tag: Rmet_0232 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Rmet_0232	uvrD	ATP-dependent DNA helicase II
Position: -150 Score: 6.1 Sequence: CACTGTATGTTCATACAGTA Locus tag: Rmet_4549 Name: uvrA Funciton: Excinuclease ABC subunit A
	Rmet_4549	uvrA	Excinuclease ABC subunit A
Position: -42 Score: 6.3 Sequence: CACTGTATATTTATACAGTG Locus tag: Rmet_5910 Name: H16_B2553 Funciton: Conserved hypothetical protein
	Rmet_5910	H16_B2553	Conserved hypothetical protein
Position: -48 Score: 6.5 Sequence: TACTGTATATTTATACAGTA Locus tag: Rmet_0742 Name: PF04055 Funciton: DNA repair photolyase
	Rmet_0742	PF04055	DNA repair photolyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Ralstonia metallidurans CH34

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --