Regulon of LexA in Ralstonia eutropha H16

Properties
Regulator type:	Transcription factor
TF locus tag:	H16_A2281
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Ralstonia
Statistics of regulated genes:
- Genes	13
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5.7 Sequence: CCCTGTATGGATATACAGTT Locus tag: H16_A0305 Name: uvrD Funciton: ATP-dependent DNA helicase II
	H16_A0305	uvrD	ATP-dependent DNA helicase II
Position: -121 Score: 5.4 Sequence: TACTGTATAAAATCACAGCA Position: -101 Score: 6 Sequence: TACTGTTTAAACATACAGTG Locus tag: H16_A2281 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	H16_A2281	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -103 Score: 6.3 Sequence: TACTGTATATTCATACAGTT Locus tag: H16_B1265 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	H16_B1265	PF06733	DinG family ATP-dependent helicase CPE1197
Position: -51 Score: 6.4 Sequence: TACTGTATATATTTACAGTA Position: -32 Score: 5.3 Sequence: ACCTGTATGGATGAACAGTA Locus tag: H16_B0943 Name: BPSS1334 Funciton: Conserved hypothetical protein
	H16_B0943	BPSS1334	Conserved hypothetical protein
Position: -72 Score: 6.3 Sequence: TACTGTATAAATATACAGTT Locus tag: H16_B1060 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: H16_B1061 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: H16_B1062 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
	H16_B1060	imuA	Predicted RecA/RadA recombinase
	H16_B1061	imuB	DNA polymerase-like protein PA0670
	H16_B1062	dnaE2	macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
Position: -159 Score: 6.1 Sequence: TACTGTTTTTTTATACAGTA Locus tag: H16_A0544 Name: recA Funciton: Recombinase A Locus tag: H16_A0545 Name: recX Funciton: Regulatory protein RecX
	H16_A0544	recA	Recombinase A
	H16_A0545	recX	Regulatory protein RecX
Position: -72 Score: 5.7 Sequence: GACTGTATGGATGTACAGTG Locus tag: H16_B1571 Name: uvrA Funciton: Excinuclease ABC subunit A
	H16_B1571	uvrA	Excinuclease ABC subunit A
Position: -51 Score: 6 Sequence: GACTGTATATTCGTACAGTA Locus tag: H16_B2553 Name: H16_B2553 Funciton: Conserved hypothetical protein
	H16_B2553	H16_B2553	Conserved hypothetical protein
Position: 41 Score: 5.9 Sequence: TACTGTACATCCATACAGTA Locus tag: H16_A1352 Name: H16_A1352 Funciton: Conserved hypothetical protein
	H16_A1352	H16_A1352	Conserved hypothetical protein
Position: -44 Score: 6.5 Sequence: TACTGTATATATATACAGTG Locus tag: H16_A0887 Name: PF04055 Funciton: DNA repair photolyase
	H16_A0887	PF04055	DNA repair photolyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Ralstonia eutropha H16

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --