Regulon of LexA in Ralstonia solanacearum GMI1000

Properties
Regulator type:	Transcription factor
TF locus tag:	RSc1304
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Ralstonia
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -159 Score: 6.2 Sequence: TACTGTATATCCATACAGTA Locus tag: RS01909 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: RS01908 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: RSp0800 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
	RS01909	imuA	Predicted RecA/RadA recombinase
	RS01908	imuB	DNA polymerase-like protein PA0670
	RSp0800	dnaE2	macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
Position: -180 Score: 5.5 Sequence: CACTGGTTTTTTATACAGTA Locus tag: RSc0551 Name: recA Funciton: Recombinase A Locus tag: RSc0552 Name: recX Funciton: Regulatory protein RecX
	RSc0551	recA	Recombinase A
	RSc0552	recX	Regulatory protein RecX
Position: -44 Score: 5.3 Sequence: CACTGTATAAAATCACAGCA Position: -25 Score: 5.4 Sequence: ACCTGTTCAAATATACAGTG Locus tag: RSc1304 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	RSc1304	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -44 Score: 5.9 Sequence: GCCTGTATATATTTACAGTG Position: -29 Score: 5.2 Sequence: CAGTGTACGTATATACAGTC Locus tag: RS00884 Name: BPSS1334 Funciton: Conserved hypothetical protein
	RS00884	BPSS1334	Conserved hypothetical protein
Position: -39 Score: 6 Sequence: TGCTGTATATTTATACAGTT Locus tag: RS05321 Name: uvrD Funciton: ATP-dependent DNA helicase II
	RS05321	uvrD	ATP-dependent DNA helicase II

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD