Regulon of SoxR in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_e00030
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhodospirillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 6.4 Sequence: ACCTCAAGTTCGGTTGAGGT Locus tag: AZL_e00020 Name: COG3448 Funciton: CBS-domain-containing membrane protein
	AZL_e00020	COG3448	CBS-domain-containing membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD