Regulog SoxR - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | ||
| Magnetospirillum magnetotacticum MS-1 | ||
| Magnetospirillum magneticum AMB-1 | ||
| Azospirillum sp. B510 | 1 | 1 |
| Rhodospirillum centenum SW | ||
| Gluconacetobacter diazotrophicus PAl 5 | ||
| Acetobacter pasteurianus IFO 3283-01 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| COG3448 |
|
Gene: Magn03004630: CBS-domain-containing membrane protein |
|
*
Azospirillum sp. B510 Site: position = -85 score = 6.41091 sequence = ACCTCAAGTTCGGTTGAGGT Gene: AZL_e00020: CBS-domain-containing membrane protein |
|
|
|
|
|
CBS-domain-containing membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |