Regulog SoxR - Rhodospirillales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510	1	1
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
COG3448	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03004630: CBS-domain-containing membrane protein	Magnetospirillum magneticum AMB-1	* Azospirillum sp. B510 Site: position = -85 score = 6.41091 sequence = ACCTCAAGTTCGGTTGAGGT Gene: AZL_e00020: CBS-domain-containing membrane protein	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	CBS-domain-containing membrane protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --