Profile of regulator SoxR in Rhodospirillales
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Regulog: | SoxR - Rhodospirillales |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Azospirillum sp. B510 | |||||
| AZL_e00020 | COG3448 | -85 | 6.4 | ACCTCAAGTTCGGTTGAGGT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |