Statistics of regulated genes

Genome	Genes	Operons
Desulfovibrio vulgaris Hildenborough	2	1
Desulfovibrio vulgaris str. Miyazaki F	2	1
Desulfovibrio desulfuricans G20	2	1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio magneticus RS-1	5	2
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028	2	1
Desulfohalobium retbaense DSM 5692	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes											Function
CRON 1.
hrcA	Desulfovibrio vulgaris Hildenborough Gene: DVU0813: Heat shock response transcriptional regulator HrcA, HrcA family	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1195: Heat shock response transcriptional regulator HrcA, HrcA family	Desulfovibrio desulfuricans G20 Gene: Dde_1026: Heat shock response transcriptional regulator HrcA, HrcA family	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	* Desulfovibrio magneticus RS-1 Site: position = -40 score = 5.80609 sequence = TTGGCACTCGAAAGCCACGAGTGCCAA Gene: DMR_17390: Heat shock response transcriptional regulator HrcA, HrcA family	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_2882: Heat shock response transcriptional regulator HrcA, HrcA family	Desulfohalobium retbaense DSM 5692 Gene: Dret_0305: Heat shock response transcriptional regulator HrcA, HrcA family	Heat shock response transcriptional regulator HrcA, HrcA family
grpE	Desulfovibrio vulgaris Hildenborough Gene: DVU0812: Heat shock protein GrpE	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1194: Heat shock protein GrpE	Desulfovibrio desulfuricans G20 Gene: Dde_1025: Heat shock protein GrpE	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_1053: Heat shock protein GrpE	Desulfovibrio piger ATCC 29098 Gene: DESPIG_00447: Heat shock protein GrpE	Desulfovibrio salexigens DSM 2638 Gene: Desal_1567: Heat shock protein GrpE	Desulfovibrio magneticus RS-1 Gene: DMR_17380: Heat shock protein GrpE	Lawsonia intracellularis PHE/MN1-00 Gene: LI1048: Heat shock protein GrpE	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_2881: Heat shock protein GrpE	Desulfohalobium retbaense DSM 5692 Gene: Dret_0304: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Desulfovibrio vulgaris Hildenborough Gene: DVU0811: Chaperone protein DnaK	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2835: Chaperone protein DnaK	Desulfovibrio desulfuricans G20 Gene: Dde_1023: Chaperone protein DnaK	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_2151: Chaperone protein DnaK	Desulfovibrio piger ATCC 29098 Gene: DESPIG_02364: Chaperone protein DnaK	Desulfovibrio salexigens DSM 2638 Gene: Desal_1566: Chaperone protein DnaK	Desulfovibrio magneticus RS-1 Gene: DMR_17370: Chaperone protein DnaK	Lawsonia intracellularis PHE/MN1-00 Gene: LI0912: Chaperone protein DnaK	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_2893: Chaperone protein DnaK	Desulfohalobium retbaense DSM 5692 Gene: Dret_0303: Chaperone protein DnaK	Chaperone protein DnaK
CRON 2.
groS	* Desulfovibrio vulgaris Hildenborough Site: position = -69 score = 6.58148 sequence = CTGGCACTCATCACAAGAGAGTGCCAA Gene: DVU1977: Heat shock protein 60 family co-chaperone GroES	* Desulfovibrio vulgaris str. Miyazaki F Site: position = -72 score = 6.09047 sequence = TTGGCACTCGCACCCCGCGAGTGCCAA Gene: DvMF_3063: Heat shock protein 60 family co-chaperone GroES	* Desulfovibrio desulfuricans G20 Site: position = -69 score = 7.17366 sequence = TTGGCACTCGCGTGAAGAGAGTGCTAA Gene: Dde_2474: Heat shock protein 60 family co-chaperone GroES	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_1547: Heat shock protein 60 family co-chaperone GroES	Desulfovibrio piger ATCC 29098 Gene: DESPIG_00652: Heat shock protein 60 family co-chaperone GroES	Desulfovibrio salexigens DSM 2638 Gene: Desal_3023: Heat shock protein 60 family co-chaperone GroES	* Desulfovibrio magneticus RS-1 Site: position = -65 score = 5.8817 sequence = CTGGCACTCGCCGCAAGCGAGTGCCAG Gene: DMR_02720: Heat shock protein 60 family co-chaperone GroES	Lawsonia intracellularis PHE/MN1-00 Gene: LI0624: Heat shock protein 60 family co-chaperone GroES	* Desulfomicrobium baculatum DSM 4028 Site: position = -76 score = 5.87827 sequence = TTGGCACTCCCCATTGCCGAGCGCCAA Gene: Dbac_2625: Heat shock protein 60 family co-chaperone GroES	* Desulfohalobium retbaense DSM 5692 Site: position = -69 score = 6.81158 sequence = TTAGCACTCCCCTGACAGGAGTGCTAA Gene: Dret_2175: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Desulfovibrio vulgaris Hildenborough Gene: DVU1976: Heat shock protein 60 family chaperone GroEL	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_3064: Heat shock protein 60 family chaperone GroEL	Desulfovibrio desulfuricans G20 Gene: Dde_2473: Heat shock protein 60 family chaperone GroEL	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_1548: Heat shock protein 60 family chaperone GroEL	Desulfovibrio piger ATCC 29098 Gene: DESPIG_00651: Heat shock protein 60 family chaperone GroEL	Desulfovibrio salexigens DSM 2638 Gene: Desal_3024: Heat shock protein 60 family chaperone GroEL	Desulfovibrio magneticus RS-1 Gene: DMR_02710: Heat shock protein 60 family chaperone GroEL	Lawsonia intracellularis PHE/MN1-00 Gene: LI0625: Heat shock protein 60 family chaperone GroEL	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_2624: Heat shock protein 60 family chaperone GroEL	Desulfohalobium retbaense DSM 5692 Gene: Dret_2176: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD