Regulog HrcA - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | 2 | 1 |
| Desulfovibrio vulgaris str. Miyazaki F | 2 | 1 |
| Desulfovibrio desulfuricans G20 | 2 | 1 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio magneticus RS-1 | 5 | 2 |
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | 2 | 1 |
| Desulfohalobium retbaense DSM 5692 | 2 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| hrcA |
Gene: DVU0813: Heat shock response transcriptional regulator HrcA, HrcA family |
Gene: DvMF_1195: Heat shock response transcriptional regulator HrcA, HrcA family |
Gene: Dde_1026: Heat shock response transcriptional regulator HrcA, HrcA family |
|
|
|
*
Desulfovibrio magneticus RS-1 Site: position = -40 score = 5.80609 sequence = TTGGCACTCGAAAGCCACGAGTGCCAA Gene: DMR_17390: Heat shock response transcriptional regulator HrcA, HrcA family |
|
Gene: Dbac_2882: Heat shock response transcriptional regulator HrcA, HrcA family |
Gene: Dret_0305: Heat shock response transcriptional regulator HrcA, HrcA family |
Heat shock response transcriptional regulator HrcA, HrcA family |
| grpE |
Gene: DVU0812: Heat shock protein GrpE |
Gene: DvMF_1194: Heat shock protein GrpE |
Gene: Dde_1025: Heat shock protein GrpE |
Gene: Ddes_1053: Heat shock protein GrpE |
Gene: DESPIG_00447: Heat shock protein GrpE |
Gene: Desal_1567: Heat shock protein GrpE |
Gene: DMR_17380: Heat shock protein GrpE |
Gene: LI1048: Heat shock protein GrpE |
Gene: Dbac_2881: Heat shock protein GrpE |
Gene: Dret_0304: Heat shock protein GrpE |
Heat shock protein GrpE |
| dnaK |
Gene: DVU0811: Chaperone protein DnaK |
Gene: DvMF_2835: Chaperone protein DnaK |
Gene: Dde_1023: Chaperone protein DnaK |
Gene: Ddes_2151: Chaperone protein DnaK |
Gene: DESPIG_02364: Chaperone protein DnaK |
Gene: Desal_1566: Chaperone protein DnaK |
Gene: DMR_17370: Chaperone protein DnaK |
Gene: LI0912: Chaperone protein DnaK |
Gene: Dbac_2893: Chaperone protein DnaK |
Gene: Dret_0303: Chaperone protein DnaK |
Chaperone protein DnaK |
| CRON 2. | |||||||||||
| groS |
*
Desulfovibrio vulgaris Hildenborough Site: position = -69 score = 6.58148 sequence = CTGGCACTCATCACAAGAGAGTGCCAA Gene: DVU1977: Heat shock protein 60 family co-chaperone GroES |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -72 score = 6.09047 sequence = TTGGCACTCGCACCCCGCGAGTGCCAA Gene: DvMF_3063: Heat shock protein 60 family co-chaperone GroES |
*
Desulfovibrio desulfuricans G20 Site: position = -69 score = 7.17366 sequence = TTGGCACTCGCGTGAAGAGAGTGCTAA Gene: Dde_2474: Heat shock protein 60 family co-chaperone GroES |
Gene: Ddes_1547: Heat shock protein 60 family co-chaperone GroES |
Gene: DESPIG_00652: Heat shock protein 60 family co-chaperone GroES |
Gene: Desal_3023: Heat shock protein 60 family co-chaperone GroES |
*
Desulfovibrio magneticus RS-1 Site: position = -65 score = 5.8817 sequence = CTGGCACTCGCCGCAAGCGAGTGCCAG Gene: DMR_02720: Heat shock protein 60 family co-chaperone GroES |
Gene: LI0624: Heat shock protein 60 family co-chaperone GroES |
*
Desulfomicrobium baculatum DSM 4028 Site: position = -76 score = 5.87827 sequence = TTGGCACTCCCCATTGCCGAGCGCCAA Gene: Dbac_2625: Heat shock protein 60 family co-chaperone GroES |
*
Desulfohalobium retbaense DSM 5692 Site: position = -69 score = 6.81158 sequence = TTAGCACTCCCCTGACAGGAGTGCTAA Gene: Dret_2175: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: DVU1976: Heat shock protein 60 family chaperone GroEL |
Gene: DvMF_3064: Heat shock protein 60 family chaperone GroEL |
Gene: Dde_2473: Heat shock protein 60 family chaperone GroEL |
Gene: Ddes_1548: Heat shock protein 60 family chaperone GroEL |
Gene: DESPIG_00651: Heat shock protein 60 family chaperone GroEL |
Gene: Desal_3024: Heat shock protein 60 family chaperone GroEL |
Gene: DMR_02710: Heat shock protein 60 family chaperone GroEL |
Gene: LI0625: Heat shock protein 60 family chaperone GroEL |
Gene: Dbac_2624: Heat shock protein 60 family chaperone GroEL |
Gene: Dret_2176: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |