Regulon of HrcA in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_1195
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.1 Sequence: TTGGCACTCGCACCCCGCGAGTGCCAA Locus tag: DvMF_3063 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: DvMF_3064 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	DvMF_3063	groS	Heat shock protein 60 family co-chaperone GroES
	DvMF_3064	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD