Regulon of HrcA in Desulfovibrio magneticus RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	DMR_17390
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Desulfovibrionales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 5.8 Sequence: TTGGCACTCGAAAGCCACGAGTGCCAA Locus tag: DMR_17390 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: DMR_17380 Name: grpE Funciton: Heat shock protein GrpE Locus tag: DMR_17370 Name: dnaK Funciton: Chaperone protein DnaK
	DMR_17390	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	DMR_17380	grpE	Heat shock protein GrpE
	DMR_17370	dnaK	Chaperone protein DnaK
Position: -65 Score: 5.9 Sequence: CTGGCACTCGCCGCAAGCGAGTGCCAG Locus tag: DMR_02720 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: DMR_02710 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	DMR_02720	groS	Heat shock protein 60 family co-chaperone GroES
	DMR_02710	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD