Regulog HrcA - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Statistics of regulated genes
Genome	Genes	Operons
Bacillus subtilis subsp. subtilis str. 168	5	2
Bacillus amyloliquefaciens FZB42	5	2
Bacillus pumilus SAFR-032	5	2
Bacillus licheniformis DSM 13	5	2
Anoxybacillus flavithermus WK1	5	2
Geobacillus kaustophilus HTA426	5	2
Bacillus cereus ATCC 14579	5	2
Bacillus halodurans C-125	6	3
Bacillus clausii KSM-K16	6	3
Oceanobacillus iheyensis HTE831	6	3
Paenibacillus sp. JDR-2	6	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
htpG	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU39820: Heat shock chaperone protein 90	Bacillus amyloliquefaciens FZB42 Gene: RBAM_036820: Heat shock chaperone protein 90	Bacillus pumilus SAFR-032 Gene: BPUM_0652: Heat shock chaperone protein 90	Bacillus licheniformis DSM 13 Gene: BLi04256: Heat shock chaperone protein 90	Anoxybacillus flavithermus WK1	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579	* Bacillus halodurans C-125 Site: position = -126 score = 7.12565 sequence = TTAGCACTCGTTGCTTGCAAGTGCTAA Gene: BH1007: Heat shock chaperone protein 90	* Bacillus clausii KSM-K16 Site: position = -63 score = 7.52063 sequence = TTAGCACTCTAAACAAACGAGTGCTAA Gene: ABC0970: Heat shock chaperone protein 90	* Oceanobacillus iheyensis HTE831 Site: position = -52 score = 7.61026 sequence = TTAGCACTCGTAAGTAGTGAGTGCTAA Gene: OB3158: Heat shock chaperone protein 90	* Paenibacillus sp. JDR-2 Site: position = -64 score = 6.96768 sequence = TTAGCACTCCAACACGGAGAGTGCTAA Gene: Pjdr2_5425: Heat shock chaperone protein 90	Heat shock chaperone protein 90

CRON 2.
hrcA	* Bacillus subtilis subsp. subtilis str. 168 Site: position = -41 score = 7.49622 sequence = TTAGCACTCGCTTATTGAGAGTGCTAA Gene: BSU25490: Heat-inducible transcription repressor HrcA	* Bacillus amyloliquefaciens FZB42 Site: position = -41 score = 7.27227 sequence = TTAGCACTCGCTGACCTTGAGTGCTAA Gene: RBAM_023790: Heat-inducible transcription repressor HrcA	* Bacillus pumilus SAFR-032 Site: position = -41 score = 7.52135 sequence = TTAGCACTCGTTGAAAGAGAGTGCTAA Gene: BPUM_2282: Heat-inducible transcription repressor HrcA	* Bacillus licheniformis DSM 13 Site: position = -41 score = 7.31968 sequence = TTAGCACTCAGTTGTGCCGAGTGCTAA Gene: BLi02741: Heat-inducible transcription repressor HrcA	* Anoxybacillus flavithermus WK1 Site: position = -42 score = 7.37442 sequence = TTAGCACTCGCTTTGTTAGAGTGCTAA Gene: Aflv_0833: Heat-inducible transcription repressor HrcA	* Geobacillus kaustophilus HTA426 Site: position = -41 score = 7.37013 sequence = TTAGCACTCGAATTGTTCGAGTGCTAA Gene: GK2506: Heat-inducible transcription repressor HrcA	* Bacillus cereus ATCC 14579 Site: position = -43 score = 7.43613 sequence = TTAGCACTCAAAGACAAAGAGTGCTAA Gene: BC4314: Heat-inducible transcription repressor HrcA	* Bacillus halodurans C-125 Site: position = -114 score = 7.32807 sequence = TTAGCACTCGAACTATGAGAGTGCTAA Gene: BH1344: Heat-inducible transcription repressor HrcA	* Bacillus clausii KSM-K16 Site: position = -41 score = 7.50961 sequence = TTAGCACTCGTTGCATTTGAGTGCTAA Gene: ABC1657: Heat-inducible transcription repressor HrcA	* Oceanobacillus iheyensis HTE831 Site: position = -41 score = 7.36628 sequence = TTAGCACTCAATAATCAAGAGTGCTAA Gene: OB1970: Heat-inducible transcription repressor HrcA	* Paenibacillus sp. JDR-2 Site: position = -62 score = 7.22184 sequence = TTAGCACTCGGGCCTAATGAGTGCTAA Gene: Pjdr2_2205: Heat-inducible transcription repressor HrcA	Heat-inducible transcription repressor HrcA
grpE	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU25480: Heat shock protein GrpE	Bacillus amyloliquefaciens FZB42 Gene: RBAM_023780: Heat shock protein GrpE	Bacillus pumilus SAFR-032 Gene: BPUM_2281: Heat shock protein GrpE	Bacillus licheniformis DSM 13 Gene: BLi02740: Heat shock protein GrpE	Anoxybacillus flavithermus WK1 Gene: Aflv_0834: Heat shock protein GrpE	Geobacillus kaustophilus HTA426 Gene: GK2505: Heat shock protein GrpE	Bacillus cereus ATCC 14579 Gene: BC4313: Heat shock protein GrpE	Bacillus halodurans C-125 Gene: BH1345: Heat shock protein GrpE	Bacillus clausii KSM-K16 Gene: ABC1658: Heat shock protein GrpE	Oceanobacillus iheyensis HTE831 Gene: OB1969: Heat shock protein GrpE	Paenibacillus sp. JDR-2 Gene: Pjdr2_2206: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU25470: Chaperone protein DnaK	Bacillus amyloliquefaciens FZB42 Gene: RBAM_023770: Chaperone protein DnaK	Bacillus pumilus SAFR-032 Gene: BPUM_2280: Chaperone protein DnaK	Bacillus licheniformis DSM 13 Gene: BLi02739: Chaperone protein DnaK	Anoxybacillus flavithermus WK1 Gene: Aflv_0835: Chaperone protein DnaK	Geobacillus kaustophilus HTA426 Gene: GK2504: Chaperone protein DnaK	Bacillus cereus ATCC 14579 Gene: BC4312: Chaperone protein DnaK	Bacillus halodurans C-125 Gene: BH1346: Chaperone protein DnaK	Bacillus clausii KSM-K16 Gene: ABC1659: Chaperone protein DnaK	Oceanobacillus iheyensis HTE831 Gene: OB1968: Chaperone protein DnaK	Paenibacillus sp. JDR-2 Gene: Pjdr2_2207: Chaperone protein DnaK	Chaperone protein DnaK

CRON 3.
groES	* Bacillus subtilis subsp. subtilis str. 168 Site: position = -62 score = 7.43196 sequence = TTAGCACTCTTTAGTGCTGAGTGCTAA Gene: BSU06020: Co-chaperonin GroES (HSP10 family)	* Bacillus amyloliquefaciens FZB42 Site: position = -62 score = 7.39734 sequence = TTAGCACTCTTTAGAGCTGAGTGCTAA Gene: RBAM_006470: Co-chaperonin GroES (HSP10 family)	* Bacillus pumilus SAFR-032 Site: position = -65 score = 7.51626 sequence = TTAGCACTCACTGGTGATGAGTGCTAA Gene: BPUM_0534: Co-chaperonin GroES (HSP10 family)	* Bacillus licheniformis DSM 13 Site: position = -61 score = 7.33115 sequence = TTAGCACTCACCGAGTGCGAGTGCTAA Gene: BLi00623: Co-chaperonin GroES (HSP10 family)	* Anoxybacillus flavithermus WK1 Site: position = -64 score = 7.45775 sequence = TTAGCACTCGACCGTAATGAGTGCTAA Gene: Aflv_0211: Co-chaperonin GroES (HSP10 family)	* Geobacillus kaustophilus HTA426 Site: position = -69 score = 7.56189 sequence = TTAGCACTCAATAGTGATGAGTGCTAA Gene: GK0248: Co-chaperonin GroES (HSP10 family)	* Bacillus cereus ATCC 14579 Site: position = -67 score = 7.17303 sequence = TTAGCACTCGGATGACTTGAGTGCTAA Gene: BC0294: Co-chaperonin GroES (HSP10 family)	* Bacillus halodurans C-125 Site: position = -66 score = 7.54257 sequence = TTAGCACTCGTTTGAAGAGAGTGCTAA Gene: BH0561: Co-chaperonin GroES (HSP10 family)	* Bacillus clausii KSM-K16 Site: position = -63 score = 7.34742 sequence = TTAGCACTCATCGAATCCGAGTGCTAA Gene: ABC0881: Co-chaperonin GroES (HSP10 family)	* Oceanobacillus iheyensis HTE831 Site: position = -65 score = 7.4502 sequence = TTAGCACTCATCTATGAAGAGTGCTAA Gene: OB0655: Co-chaperonin GroES (HSP10 family)	* Paenibacillus sp. JDR-2 Site: position = -70 score = 6.76064 sequence = TTAGCACTTCAAGCTTACGAGTGCTAA Gene: Pjdr2_1050: Co-chaperonin GroES (HSP10 family)	Co-chaperonin GroES (HSP10 family)
groEL	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU06030: Chaperonin GroEL (HSP60 family)	Bacillus amyloliquefaciens FZB42 Gene: RBAM_006480: Chaperonin GroEL (HSP60 family)	Bacillus pumilus SAFR-032 Gene: BPUM_0535: Chaperonin GroEL (HSP60 family)	Bacillus licheniformis DSM 13 Gene: BLi00624: Chaperonin GroEL (HSP60 family)	Anoxybacillus flavithermus WK1 Gene: Aflv_0212: Chaperonin GroEL (HSP60 family)	Geobacillus kaustophilus HTA426 Gene: GK0249: Chaperonin GroEL (HSP60 family)	Bacillus cereus ATCC 14579 Gene: BC0295: Chaperonin GroEL (HSP60 family)	Bacillus halodurans C-125 Gene: BH0562: Chaperonin GroEL (HSP60 family)	Bacillus clausii KSM-K16 Gene: ABC0882: Chaperonin GroEL (HSP60 family)	Oceanobacillus iheyensis HTE831 Gene: OB0656: Chaperonin GroEL (HSP60 family)	Paenibacillus sp. JDR-2 Gene: Pjdr2_1051: Chaperonin GroEL (HSP60 family)	Chaperonin GroEL (HSP60 family)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog HrcA - Bacillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --