Regulog HrcA - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 5 | 2 |
| Bacillus amyloliquefaciens FZB42 | 5 | 2 |
| Bacillus pumilus SAFR-032 | 5 | 2 |
| Bacillus licheniformis DSM 13 | 5 | 2 |
| Anoxybacillus flavithermus WK1 | 5 | 2 |
| Geobacillus kaustophilus HTA426 | 5 | 2 |
| Bacillus cereus ATCC 14579 | 5 | 2 |
| Bacillus halodurans C-125 | 6 | 3 |
| Bacillus clausii KSM-K16 | 6 | 3 |
| Oceanobacillus iheyensis HTE831 | 6 | 3 |
| Paenibacillus sp. JDR-2 | 6 | 3 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| htpG |
Gene: BSU39820: Heat shock chaperone protein 90 |
Gene: RBAM_036820: Heat shock chaperone protein 90 |
Gene: BPUM_0652: Heat shock chaperone protein 90 |
Gene: BLi04256: Heat shock chaperone protein 90 |
|
|
|
*
Bacillus halodurans C-125 Site: position = -126 score = 7.12565 sequence = TTAGCACTCGTTGCTTGCAAGTGCTAA Gene: BH1007: Heat shock chaperone protein 90 |
*
Bacillus clausii KSM-K16 Site: position = -63 score = 7.52063 sequence = TTAGCACTCTAAACAAACGAGTGCTAA Gene: ABC0970: Heat shock chaperone protein 90 |
*
Oceanobacillus iheyensis HTE831 Site: position = -52 score = 7.61026 sequence = TTAGCACTCGTAAGTAGTGAGTGCTAA Gene: OB3158: Heat shock chaperone protein 90 |
*
Paenibacillus sp. JDR-2 Site: position = -64 score = 6.96768 sequence = TTAGCACTCCAACACGGAGAGTGCTAA Gene: Pjdr2_5425: Heat shock chaperone protein 90 |
Heat shock chaperone protein 90 |
| CRON 2. | ||||||||||||
| hrcA |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -41 score = 7.49622 sequence = TTAGCACTCGCTTATTGAGAGTGCTAA Gene: BSU25490: Heat-inducible transcription repressor HrcA |
*
Bacillus amyloliquefaciens FZB42 Site: position = -41 score = 7.27227 sequence = TTAGCACTCGCTGACCTTGAGTGCTAA Gene: RBAM_023790: Heat-inducible transcription repressor HrcA |
*
Bacillus pumilus SAFR-032 Site: position = -41 score = 7.52135 sequence = TTAGCACTCGTTGAAAGAGAGTGCTAA Gene: BPUM_2282: Heat-inducible transcription repressor HrcA |
*
Bacillus licheniformis DSM 13 Site: position = -41 score = 7.31968 sequence = TTAGCACTCAGTTGTGCCGAGTGCTAA Gene: BLi02741: Heat-inducible transcription repressor HrcA |
*
Anoxybacillus flavithermus WK1 Site: position = -42 score = 7.37442 sequence = TTAGCACTCGCTTTGTTAGAGTGCTAA Gene: Aflv_0833: Heat-inducible transcription repressor HrcA |
*
Geobacillus kaustophilus HTA426 Site: position = -41 score = 7.37013 sequence = TTAGCACTCGAATTGTTCGAGTGCTAA Gene: GK2506: Heat-inducible transcription repressor HrcA |
*
Bacillus cereus ATCC 14579 Site: position = -43 score = 7.43613 sequence = TTAGCACTCAAAGACAAAGAGTGCTAA Gene: BC4314: Heat-inducible transcription repressor HrcA |
*
Bacillus halodurans C-125 Site: position = -114 score = 7.32807 sequence = TTAGCACTCGAACTATGAGAGTGCTAA Gene: BH1344: Heat-inducible transcription repressor HrcA |
*
Bacillus clausii KSM-K16 Site: position = -41 score = 7.50961 sequence = TTAGCACTCGTTGCATTTGAGTGCTAA Gene: ABC1657: Heat-inducible transcription repressor HrcA |
*
Oceanobacillus iheyensis HTE831 Site: position = -41 score = 7.36628 sequence = TTAGCACTCAATAATCAAGAGTGCTAA Gene: OB1970: Heat-inducible transcription repressor HrcA |
*
Paenibacillus sp. JDR-2 Site: position = -62 score = 7.22184 sequence = TTAGCACTCGGGCCTAATGAGTGCTAA Gene: Pjdr2_2205: Heat-inducible transcription repressor HrcA |
Heat-inducible transcription repressor HrcA |
| grpE |
Gene: BSU25480: Heat shock protein GrpE |
Gene: RBAM_023780: Heat shock protein GrpE |
Gene: BPUM_2281: Heat shock protein GrpE |
Gene: BLi02740: Heat shock protein GrpE |
Gene: Aflv_0834: Heat shock protein GrpE |
Gene: GK2505: Heat shock protein GrpE |
Gene: BC4313: Heat shock protein GrpE |
Gene: BH1345: Heat shock protein GrpE |
Gene: ABC1658: Heat shock protein GrpE |
Gene: OB1969: Heat shock protein GrpE |
Gene: Pjdr2_2206: Heat shock protein GrpE |
Heat shock protein GrpE |
| dnaK |
Gene: BSU25470: Chaperone protein DnaK |
Gene: RBAM_023770: Chaperone protein DnaK |
Gene: BPUM_2280: Chaperone protein DnaK |
Gene: BLi02739: Chaperone protein DnaK |
Gene: Aflv_0835: Chaperone protein DnaK |
Gene: GK2504: Chaperone protein DnaK |
Gene: BC4312: Chaperone protein DnaK |
Gene: BH1346: Chaperone protein DnaK |
Gene: ABC1659: Chaperone protein DnaK |
Gene: OB1968: Chaperone protein DnaK |
Gene: Pjdr2_2207: Chaperone protein DnaK |
Chaperone protein DnaK |
| CRON 3. | ||||||||||||
| groES |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -62 score = 7.43196 sequence = TTAGCACTCTTTAGTGCTGAGTGCTAA Gene: BSU06020: Co-chaperonin GroES (HSP10 family) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -62 score = 7.39734 sequence = TTAGCACTCTTTAGAGCTGAGTGCTAA Gene: RBAM_006470: Co-chaperonin GroES (HSP10 family) |
*
Bacillus pumilus SAFR-032 Site: position = -65 score = 7.51626 sequence = TTAGCACTCACTGGTGATGAGTGCTAA Gene: BPUM_0534: Co-chaperonin GroES (HSP10 family) |
*
Bacillus licheniformis DSM 13 Site: position = -61 score = 7.33115 sequence = TTAGCACTCACCGAGTGCGAGTGCTAA Gene: BLi00623: Co-chaperonin GroES (HSP10 family) |
*
Anoxybacillus flavithermus WK1 Site: position = -64 score = 7.45775 sequence = TTAGCACTCGACCGTAATGAGTGCTAA Gene: Aflv_0211: Co-chaperonin GroES (HSP10 family) |
*
Geobacillus kaustophilus HTA426 Site: position = -69 score = 7.56189 sequence = TTAGCACTCAATAGTGATGAGTGCTAA Gene: GK0248: Co-chaperonin GroES (HSP10 family) |
*
Bacillus cereus ATCC 14579 Site: position = -67 score = 7.17303 sequence = TTAGCACTCGGATGACTTGAGTGCTAA Gene: BC0294: Co-chaperonin GroES (HSP10 family) |
*
Bacillus halodurans C-125 Site: position = -66 score = 7.54257 sequence = TTAGCACTCGTTTGAAGAGAGTGCTAA Gene: BH0561: Co-chaperonin GroES (HSP10 family) |
*
Bacillus clausii KSM-K16 Site: position = -63 score = 7.34742 sequence = TTAGCACTCATCGAATCCGAGTGCTAA Gene: ABC0881: Co-chaperonin GroES (HSP10 family) |
*
Oceanobacillus iheyensis HTE831 Site: position = -65 score = 7.4502 sequence = TTAGCACTCATCTATGAAGAGTGCTAA Gene: OB0655: Co-chaperonin GroES (HSP10 family) |
*
Paenibacillus sp. JDR-2 Site: position = -70 score = 6.76064 sequence = TTAGCACTTCAAGCTTACGAGTGCTAA Gene: Pjdr2_1050: Co-chaperonin GroES (HSP10 family) |
Co-chaperonin GroES (HSP10 family) |
| groEL |
Gene: BSU06030: Chaperonin GroEL (HSP60 family) |
Gene: RBAM_006480: Chaperonin GroEL (HSP60 family) |
Gene: BPUM_0535: Chaperonin GroEL (HSP60 family) |
Gene: BLi00624: Chaperonin GroEL (HSP60 family) |
Gene: Aflv_0212: Chaperonin GroEL (HSP60 family) |
Gene: GK0249: Chaperonin GroEL (HSP60 family) |
Gene: BC0295: Chaperonin GroEL (HSP60 family) |
Gene: BH0562: Chaperonin GroEL (HSP60 family) |
Gene: ABC0882: Chaperonin GroEL (HSP60 family) |
Gene: OB0656: Chaperonin GroEL (HSP60 family) |
Gene: Pjdr2_1051: Chaperonin GroEL (HSP60 family) |
Chaperonin GroEL (HSP60 family) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |