Regulon of HrcA in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi02741
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 7.3 Sequence: TTAGCACTCAGTTGTGCCGAGTGCTAA Locus tag: BLi02741 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: BLi02740 Name: grpE Funciton: Heat shock protein GrpE Locus tag: BLi02739 Name: dnaK Funciton: Chaperone protein DnaK
	BLi02741	hrcA	Heat-inducible transcription repressor HrcA
	BLi02740	grpE	Heat shock protein GrpE
	BLi02739	dnaK	Chaperone protein DnaK
Position: -61 Score: 7.3 Sequence: TTAGCACTCACCGAGTGCGAGTGCTAA Locus tag: BLi00623 Name: groES Funciton: Co-chaperonin GroES (HSP10 family) Locus tag: BLi00624 Name: groEL Funciton: Chaperonin GroEL (HSP60 family)
	BLi00623	groES	Co-chaperonin GroES (HSP10 family)
	BLi00624	groEL	Chaperonin GroEL (HSP60 family)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD