Regulon of HrcA in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_2205
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 7 Sequence: TTAGCACTCCAACACGGAGAGTGCTAA Locus tag: Pjdr2_5425 Name: htpG Funciton: Heat shock chaperone protein 90
	Pjdr2_5425	htpG	Heat shock chaperone protein 90
Position: -62 Score: 7.2 Sequence: TTAGCACTCGGGCCTAATGAGTGCTAA Locus tag: Pjdr2_2205 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Pjdr2_2206 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Pjdr2_2207 Name: dnaK Funciton: Chaperone protein DnaK
	Pjdr2_2205	hrcA	Heat-inducible transcription repressor HrcA
	Pjdr2_2206	grpE	Heat shock protein GrpE
	Pjdr2_2207	dnaK	Chaperone protein DnaK
Position: -70 Score: 6.8 Sequence: TTAGCACTTCAAGCTTACGAGTGCTAA Locus tag: Pjdr2_1050 Name: groES Funciton: Co-chaperonin GroES (HSP10 family) Locus tag: Pjdr2_1051 Name: groEL Funciton: Chaperonin GroEL (HSP60 family)
	Pjdr2_1050	groES	Co-chaperonin GroES (HSP10 family)
	Pjdr2_1051	groEL	Chaperonin GroEL (HSP60 family)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD