Regulon of HrcA in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB1970
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 7.6 Sequence: TTAGCACTCGTAAGTAGTGAGTGCTAA Locus tag: OB3158 Name: htpG Funciton: Heat shock chaperone protein 90
	OB3158	htpG	Heat shock chaperone protein 90
Position: -41 Score: 7.4 Sequence: TTAGCACTCAATAATCAAGAGTGCTAA Locus tag: OB1970 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: OB1969 Name: grpE Funciton: Heat shock protein GrpE Locus tag: OB1968 Name: dnaK Funciton: Chaperone protein DnaK
	OB1970	hrcA	Heat-inducible transcription repressor HrcA
	OB1969	grpE	Heat shock protein GrpE
	OB1968	dnaK	Chaperone protein DnaK
Position: -65 Score: 7.5 Sequence: TTAGCACTCATCTATGAAGAGTGCTAA Locus tag: OB0655 Name: groES Funciton: Co-chaperonin GroES (HSP10 family) Locus tag: OB0656 Name: groEL Funciton: Chaperonin GroEL (HSP60 family)
	OB0655	groES	Co-chaperonin GroES (HSP10 family)
	OB0656	groEL	Chaperonin GroEL (HSP60 family)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD