Regulog BglR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Cellobiose |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - ROK
- By effector - Cellobiose
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 9 | 1 |
| Thermotoga sp. RQ2 | 9 | 1 |
| Thermotoga neapolitana DSM 4359 | 12 | 1 |
| Thermotoga petrophila RKU-1 | 9 | 1 |
| Thermotoga naphthophila RKU-10 | 9 | 1 |
| Thermotoga lettingae TMO | 3 | 2 |
| Thermosipho africanus TCF52B | ||
| Thermosipho melanesiensis BI429 | ||
| Fervidobacterium nodosum Rt17-B1 | ||
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| bglX |
|
|
*
Thermotoga neapolitana DSM 4359 Site: position = -49 score = 6.45303 sequence = AATTCCTTTCTGAGGAAGATAAT Gene: CTN_0660: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 |
|
|
Gene: Tlet_1038: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 |
Gene: THA_939: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 |
Gene: Tmel_0818: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 |
|
Gene: Pmob_1924: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 |
Gene: Kole_2003: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 |
Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 |
| bglY |
|
|
Gene: CTN_0661: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 |
|
|
|
Gene: THA_940: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 |
Gene: Tmel_0819: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 |
|
Gene: Pmob_1923: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 |
Gene: Kole_2002: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 |
Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 |
| bglZ |
|
|
Gene: CTN_0662: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 |
|
|
|
Gene: THA_941: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 |
Gene: Tmel_0820: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 |
|
Gene: Pmob_1922: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 |
Gene: Kole_2001: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 |
Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 |
| bglR |
*
Thermotoga maritima MSB8 Site: position = -45 score = 6.78518 sequence = AATTTCTTTCTGAGGAAGATAGA Gene: TM0032: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family |
*
Thermotoga sp. RQ2 Site: position = -45 score = 6.78518 sequence = AATTTCTTTCTGAGGAAGATAGA Gene: TRQ2_0913: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family |
Gene: CTN_0663: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family |
*
Thermotoga petrophila RKU-1 Site: position = 29 score = 6.78518 sequence = AATtTCTTTCTGAGgAAGATAga Gene: Tpet_0891: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family |
*
Thermotoga naphthophila RKU-10 Site: position = -45 score = 6.78518 sequence = AATTTCTTTCTGAGGAAGATAGA Gene: Tnap_0663: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family |
*
Thermotoga lettingae TMO Site: position = -55 score = 6.32505 sequence = AAAATCTTTTTTAGAAAGATATT Gene: Tlet_1037: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family |
|
|
|
|
|
Cellobiose-responsive regulator of beta-glucosides utilization, ROK family |
| bglE |
Gene: TM0031: Beta-glucoside ABC transport system, sugar-binding protein |
Gene: TRQ2_0914: Beta-glucoside ABC transport system, sugar-binding protein |
Gene: CTN_0664: Beta-glucoside ABC transport system, sugar-binding protein |
Gene: Tpet_0892: Beta-glucoside ABC transport system, sugar-binding protein |
Gene: Tnap_0662: Beta-glucoside ABC transport system, sugar-binding protein |
|
|
|
|
|
|
Beta-glucoside ABC transport system, sugar-binding protein |
| bglF |
Gene: TM0030: Beta-glucoside ABC transport system, permease protein 1 |
Gene: TRQ2_0915: Beta-glucoside ABC transport system, permease protein 1 |
Gene: CTN_0665: Beta-glucoside ABC transport system, permease protein 1 |
Gene: Tpet_0893: Beta-glucoside ABC transport system, permease protein 1 |
Gene: Tnap_0661: Beta-glucoside ABC transport system, permease protein 1 |
|
|
|
|
|
|
Beta-glucoside ABC transport system, permease protein 1 |
| bglG |
Gene: TM0029: Beta-glucoside ABC transport system, permease protein 2 |
Gene: TRQ2_0916: Beta-glucoside ABC transport system, permease protein 2 |
Gene: CTN_0666: Beta-glucoside ABC transport system, permease protein 2 |
Gene: Tpet_0894: Beta-glucoside ABC transport system, permease protein 2 |
Gene: Tnap_0660: Beta-glucoside ABC transport system, permease protein 2 |
|
|
|
|
|
|
Beta-glucoside ABC transport system, permease protein 2 |
| bglK |
Gene: TM0028: Beta-glucoside ABC transport system, ATP-binding protein 1 |
Gene: TRQ2_0917: Beta-glucoside ABC transport system, ATP-binding protein 1 |
Gene: CTN_0667: Beta-glucoside ABC transport system, ATP-binding protein 1 |
Gene: Tpet_0895: Beta-glucoside ABC transport system, ATP-binding protein 1 |
Gene: Tnap_0659: Beta-glucoside ABC transport system, ATP-binding protein 1 |
|
|
|
|
|
|
Beta-glucoside ABC transport system, ATP-binding protein 1 |
| bglL |
Gene: TM0027: Beta-glucoside ABC transport system, ATP-binding protein 2 |
Gene: TRQ2_0918: Beta-glucoside ABC transport system, ATP-binding protein 2 |
Gene: CTN_0668: Beta-glucoside ABC transport system, ATP-binding protein 2 |
Gene: Tpet_0896: Beta-glucoside ABC transport system, ATP-binding protein 2 |
Gene: Tnap_0658: Beta-glucoside ABC transport system, ATP-binding protein 2 |
|
|
|
|
|
|
Beta-glucoside ABC transport system, ATP-binding protein 2 |
| TM0026 |
Gene: TM0026: Hypothetical protein TM0026, BglR regulon |
Gene: TRQ2_0919: Hypothetical protein TM0026, BglR regulon |
Gene: CTN_0669: Hypothetical protein TM0026, BglR regulon |
Gene: Tpet_0897: Hypothetical protein TM0026, BglR regulon |
Gene: Tnap_0657: Hypothetical protein TM0026, BglR regulon |
|
|
|
|
|
|
Hypothetical protein TM0026, BglR regulon |
| bglB |
Gene: TM0025: Beta-glucosidase (EC 3.2.1.21) |
Gene: TRQ2_0920: Beta-glucosidase (EC 3.2.1.21) |
Gene: CTN_0670: Beta-glucosidase (EC 3.2.1.21) |
Gene: Tpet_0898: Beta-glucosidase (EC 3.2.1.21) |
Gene: Tnap_0656: Beta-glucosidase (EC 3.2.1.21) |
*
Thermotoga lettingae TMO Site: position = -121 score = 6.00138 sequence = TAAATCTTTTTCAGAAAGATAAA Gene: Tlet_1036: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
|
|
Beta-glucosidase (EC 3.2.1.21) |
| lamA |
Gene: TM0024: Laminarinase (EC 3.2.1.39) |
Gene: TRQ2_0921: Laminarinase (EC 3.2.1.39) |
Gene: CTN_0671: Laminarinase (EC 3.2.1.39) |
Gene: Tpet_0899: Laminarinase (EC 3.2.1.39) |
Gene: Tnap_0655: Laminarinase (EC 3.2.1.39) |
|
|
|
|
|
|
Laminarinase (EC 3.2.1.39) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |