Regulog BglR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Cellobiose
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Cellobiose
By pathway - Beta-glucosides utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	9	1
Thermotoga sp. RQ2	9	1
Thermotoga neapolitana DSM 4359	12	1
Thermotoga petrophila RKU-1	9	1
Thermotoga naphthophila RKU-10	9	1
Thermotoga lettingae TMO	3	2
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
bglX	Thermotoga maritima MSB8	Thermotoga sp. RQ2	* Thermotoga neapolitana DSM 4359 Site: position = -49 score = 6.45303 sequence = AATTCCTTTCTGAGGAAGATAAT Gene: CTN_0660: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1038: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653	Thermosipho africanus TCF52B Gene: THA_939: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653	Thermosipho melanesiensis BI429 Gene: Tmel_0818: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_1924: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653	Thermotogales bacterium TBF 19.5.1 Gene: Kole_2003: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653	Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
bglY	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0661: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B Gene: THA_940: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175	Thermosipho melanesiensis BI429 Gene: Tmel_0819: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_1923: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175	Thermotogales bacterium TBF 19.5.1 Gene: Kole_2002: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175	Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
bglZ	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0662: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B Gene: THA_941: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395	Thermosipho melanesiensis BI429 Gene: Tmel_0820: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_1922: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395	Thermotogales bacterium TBF 19.5.1 Gene: Kole_2001: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395	Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
bglR	* Thermotoga maritima MSB8 Site: position = -45 score = 6.78518 sequence = AATTTCTTTCTGAGGAAGATAGA Gene: TM0032: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family	* Thermotoga sp. RQ2 Site: position = -45 score = 6.78518 sequence = AATTTCTTTCTGAGGAAGATAGA Gene: TRQ2_0913: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family	Thermotoga neapolitana DSM 4359 Gene: CTN_0663: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family	* Thermotoga petrophila RKU-1 Site: position = 29 score = 6.78518 sequence = AATtTCTTTCTGAGgAAGATAga Gene: Tpet_0891: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family	* Thermotoga naphthophila RKU-10 Site: position = -45 score = 6.78518 sequence = AATTTCTTTCTGAGGAAGATAGA Gene: Tnap_0663: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family	* Thermotoga lettingae TMO Site: position = -55 score = 6.32505 sequence = AAAATCTTTTTTAGAAAGATATT Gene: Tlet_1037: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
bglE	Thermotoga maritima MSB8 Gene: TM0031: Beta-glucoside ABC transport system, sugar-binding protein	Thermotoga sp. RQ2 Gene: TRQ2_0914: Beta-glucoside ABC transport system, sugar-binding protein	Thermotoga neapolitana DSM 4359 Gene: CTN_0664: Beta-glucoside ABC transport system, sugar-binding protein	Thermotoga petrophila RKU-1 Gene: Tpet_0892: Beta-glucoside ABC transport system, sugar-binding protein	Thermotoga naphthophila RKU-10 Gene: Tnap_0662: Beta-glucoside ABC transport system, sugar-binding protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-glucoside ABC transport system, sugar-binding protein
bglF	Thermotoga maritima MSB8 Gene: TM0030: Beta-glucoside ABC transport system, permease protein 1	Thermotoga sp. RQ2 Gene: TRQ2_0915: Beta-glucoside ABC transport system, permease protein 1	Thermotoga neapolitana DSM 4359 Gene: CTN_0665: Beta-glucoside ABC transport system, permease protein 1	Thermotoga petrophila RKU-1 Gene: Tpet_0893: Beta-glucoside ABC transport system, permease protein 1	Thermotoga naphthophila RKU-10 Gene: Tnap_0661: Beta-glucoside ABC transport system, permease protein 1	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-glucoside ABC transport system, permease protein 1
bglG	Thermotoga maritima MSB8 Gene: TM0029: Beta-glucoside ABC transport system, permease protein 2	Thermotoga sp. RQ2 Gene: TRQ2_0916: Beta-glucoside ABC transport system, permease protein 2	Thermotoga neapolitana DSM 4359 Gene: CTN_0666: Beta-glucoside ABC transport system, permease protein 2	Thermotoga petrophila RKU-1 Gene: Tpet_0894: Beta-glucoside ABC transport system, permease protein 2	Thermotoga naphthophila RKU-10 Gene: Tnap_0660: Beta-glucoside ABC transport system, permease protein 2	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-glucoside ABC transport system, permease protein 2
bglK	Thermotoga maritima MSB8 Gene: TM0028: Beta-glucoside ABC transport system, ATP-binding protein 1	Thermotoga sp. RQ2 Gene: TRQ2_0917: Beta-glucoside ABC transport system, ATP-binding protein 1	Thermotoga neapolitana DSM 4359 Gene: CTN_0667: Beta-glucoside ABC transport system, ATP-binding protein 1	Thermotoga petrophila RKU-1 Gene: Tpet_0895: Beta-glucoside ABC transport system, ATP-binding protein 1	Thermotoga naphthophila RKU-10 Gene: Tnap_0659: Beta-glucoside ABC transport system, ATP-binding protein 1	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-glucoside ABC transport system, ATP-binding protein 1
bglL	Thermotoga maritima MSB8 Gene: TM0027: Beta-glucoside ABC transport system, ATP-binding protein 2	Thermotoga sp. RQ2 Gene: TRQ2_0918: Beta-glucoside ABC transport system, ATP-binding protein 2	Thermotoga neapolitana DSM 4359 Gene: CTN_0668: Beta-glucoside ABC transport system, ATP-binding protein 2	Thermotoga petrophila RKU-1 Gene: Tpet_0896: Beta-glucoside ABC transport system, ATP-binding protein 2	Thermotoga naphthophila RKU-10 Gene: Tnap_0658: Beta-glucoside ABC transport system, ATP-binding protein 2	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-glucoside ABC transport system, ATP-binding protein 2
TM0026	Thermotoga maritima MSB8 Gene: TM0026: Hypothetical protein TM0026, BglR regulon	Thermotoga sp. RQ2 Gene: TRQ2_0919: Hypothetical protein TM0026, BglR regulon	Thermotoga neapolitana DSM 4359 Gene: CTN_0669: Hypothetical protein TM0026, BglR regulon	Thermotoga petrophila RKU-1 Gene: Tpet_0897: Hypothetical protein TM0026, BglR regulon	Thermotoga naphthophila RKU-10 Gene: Tnap_0657: Hypothetical protein TM0026, BglR regulon	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Hypothetical protein TM0026, BglR regulon
bglB	Thermotoga maritima MSB8 Gene: TM0025: Beta-glucosidase (EC 3.2.1.21)	Thermotoga sp. RQ2 Gene: TRQ2_0920: Beta-glucosidase (EC 3.2.1.21)	Thermotoga neapolitana DSM 4359 Gene: CTN_0670: Beta-glucosidase (EC 3.2.1.21)	Thermotoga petrophila RKU-1 Gene: Tpet_0898: Beta-glucosidase (EC 3.2.1.21)	Thermotoga naphthophila RKU-10 Gene: Tnap_0656: Beta-glucosidase (EC 3.2.1.21)	* Thermotoga lettingae TMO Site: position = -121 score = 6.00138 sequence = TAAATCTTTTTCAGAAAGATAAA Gene: Tlet_1036: Beta-glucosidase (EC 3.2.1.21)	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-glucosidase (EC 3.2.1.21)
lamA	Thermotoga maritima MSB8 Gene: TM0024: Laminarinase (EC 3.2.1.39)	Thermotoga sp. RQ2 Gene: TRQ2_0921: Laminarinase (EC 3.2.1.39)	Thermotoga neapolitana DSM 4359 Gene: CTN_0671: Laminarinase (EC 3.2.1.39)	Thermotoga petrophila RKU-1 Gene: Tpet_0899: Laminarinase (EC 3.2.1.39)	Thermotoga naphthophila RKU-10 Gene: Tnap_0655: Laminarinase (EC 3.2.1.39)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Laminarinase (EC 3.2.1.39)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BglR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --