Regulon of BglR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0663
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Cellobiose
Regulog:	BglR - Thermotogales
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Cellobiose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 6.8 Sequence: AATTTCTTTCTGAGGAAGATAGA Locus tag: Tnap_0663 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: Tnap_0662 Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein Locus tag: Tnap_0661 Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1 Locus tag: Tnap_0660 Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2 Locus tag: Tnap_0659 Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1 Locus tag: Tnap_0658 Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2 Locus tag: Tnap_0657 Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon Locus tag: Tnap_0656 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Tnap_0655 Name: lamA Funciton: Laminarinase (EC 3.2.1.39)
	Tnap_0663	bglR	Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
	Tnap_0662	bglE	Beta-glucoside ABC transport system, sugar-binding protein
	Tnap_0661	bglF	Beta-glucoside ABC transport system, permease protein 1
	Tnap_0660	bglG	Beta-glucoside ABC transport system, permease protein 2
	Tnap_0659	bglK	Beta-glucoside ABC transport system, ATP-binding protein 1
	Tnap_0658	bglL	Beta-glucoside ABC transport system, ATP-binding protein 2
	Tnap_0657	TM0026	Hypothetical protein TM0026, BglR regulon
	Tnap_0656	bglB	Beta-glucosidase (EC 3.2.1.21)
	Tnap_0655	lamA	Laminarinase (EC 3.2.1.39)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD