Regulon of BglR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_0581
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Cellobiose
Regulog:	BglR - Thermotogales
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Cellobiose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.5 Sequence: AATTCCTTTCTGAGGAAGATAAT Locus tag: CTN_0660 Name: bglX Funciton: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 Locus tag: CTN_0661 Name: bglY Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 Locus tag: CTN_0662 Name: bglZ Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 Locus tag: CTN_0663 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: CTN_0664 Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein Locus tag: CTN_0665 Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1 Locus tag: CTN_0666 Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2 Locus tag: CTN_0667 Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1 Locus tag: CTN_0668 Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2 Locus tag: CTN_0669 Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon Locus tag: CTN_0670 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: CTN_0671 Name: lamA Funciton: Laminarinase (EC 3.2.1.39)
	CTN_0660	bglX	Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
	CTN_0661	bglY	Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
	CTN_0662	bglZ	Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
	CTN_0663	bglR	Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
	CTN_0664	bglE	Beta-glucoside ABC transport system, sugar-binding protein
	CTN_0665	bglF	Beta-glucoside ABC transport system, permease protein 1
	CTN_0666	bglG	Beta-glucoside ABC transport system, permease protein 2
	CTN_0667	bglK	Beta-glucoside ABC transport system, ATP-binding protein 1
	CTN_0668	bglL	Beta-glucoside ABC transport system, ATP-binding protein 2
	CTN_0669	TM0026	Hypothetical protein TM0026, BglR regulon
	CTN_0670	bglB	Beta-glucosidase (EC 3.2.1.21)
	CTN_0671	lamA	Laminarinase (EC 3.2.1.39)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD