Regulon of BglR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_1037
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Cellobiose
Regulog:	BglR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Cellobiose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 6.3 Sequence: AAAATCTTTTTTAGAAAGATATT Locus tag: Tlet_1037 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: Tlet_1038 Name: bglX Funciton: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
	Tlet_1037	bglR	Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
	Tlet_1038	bglX	Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
Position: -121 Score: 6 Sequence: TAAATCTTTTTCAGAAAGATAAA Locus tag: Tlet_1036 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
	Tlet_1036	bglB	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD