Regulog MalR - Bacteroidaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacteroidaceae
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | 11 | 4 |
| Bacteroides coprophilus DSM 18228 | ||
| Bacteroides dorei DSM 17855 | ||
| Bacteroides eggerthii DSM 20697 | 12 | 6 |
| Bacteroides fragilis NCTC 9343 | 8 | 4 |
| Bacteroides ovatus ATCC 8483 | ||
| Bacteroides plebeius DSM 17135 | ||
| Bacteroides stercoris ATCC 43183 | 15 | 7 |
| Bacteroides thetaiotaomicron VPI-5482 | ||
| Bacteroides uniformis ATCC 8492 | 10 | 7 |
| Bacteroides vulgatus ATCC 8482 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| susB |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -114 score = 5.68823 sequence = TTATGCAAACGTTTGCCGGT Gene: BACCELL_03487: Alpha-glucosidase SusB (EC 3.2.1.20) |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -109 score = 5.74868 sequence = TTATGCAAACGTTTTCTGAC Gene: BACEGG_01482: Alpha-glucosidase SusB (EC 3.2.1.20) |
*
Bacteroides fragilis NCTC 9343 Site: position = -100 score = 5.72845 sequence = TTATGCAAACGTTTTCTGAT Gene: BF1158: Alpha-glucosidase SusB (EC 3.2.1.20) |
Gene: BACOVA_05375: Alpha-glucosidase SusB (EC 3.2.1.20) |
|
*
Bacteroides stercoris ATCC 43183 Site: position = -104 score = 6.01789 sequence = TTATGCAAACGTTTGCTTTT Gene: BACSTE_00969: Alpha-glucosidase SusB (EC 3.2.1.20) |
Gene: BT4581: Alpha-glucosidase SusB (EC 3.2.1.20) |
*
Bacteroides uniformis ATCC 8492 Site: position = -109 score = 5.70845 sequence = TCATGCAAACGTTTGCCGAC Gene: BACUNI_01476: Alpha-glucosidase SusB (EC 3.2.1.20) |
|
Alpha-glucosidase SusB (EC 3.2.1.20) |
| CRON 2. | ||||||||||||
| susA |
Gene: BACCELL_03543: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135) |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -107 score = 5.84202 sequence = GCCTGAAAACGTTTGCATAA Gene: BACEGG_01490: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135) |
*
Bacteroides fragilis NCTC 9343 Site: position = -108 score = 6.05258 sequence = CAATGAAAACGTTTGCATAA Gene: BF3134: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135) |
|
|
*
Bacteroides stercoris ATCC 43183 Site: position = -107 score = 5.89527 sequence = CAGTGAAAACGTTTGCATAA Gene: BACSTE_00961: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135) |
|
*
Bacteroides uniformis ATCC 8492 Site: position = -107 score = 6.05258 sequence = CAATGAAAACGTTTGCATAA Gene: BACUNI_01464: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135) |
|
Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135) |
| CRON 3. | ||||||||||||
| susC |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -184 score = 5.65828 sequence = CTGTGCAATCGTTTGCACTG Gene: BACCELL_05446: SusC, outer membrane protein involved in starch binding |
Gene: BACCOPRO_01926: SusC, outer membrane protein involved in starch binding |
2
Bacteroides dorei DSM 17855 Gene: BACDOR_02279: SusC, outer membrane protein involved in starch binding Gene: BACDOR_02278: SusC, outer membrane protein involved in starch binding |
*
Bacteroides eggerthii DSM 20697 Site: position = -198 score = 5.42881 sequence = TGATGCAATCGTTTGCGCTC Site: position = -351 score = 5.61926 sequence = AAGTGCAAACGATTGCAGGA Gene: BACEGG_01900: SusC, outer membrane protein involved in starch binding |
|
Gene: BACOVA_03518: SusC, outer membrane protein involved in starch binding |
Gene: BACPLE_02370: SusC, outer membrane protein involved in starch binding |
*
Bacteroides stercoris ATCC 43183 Site: position = -190 score = 5.85005 sequence = TAGTGCAATCGTTTGCATTC Gene: BACSTE_01657: SusC, outer membrane protein involved in starch binding |
Gene: BT3702: SusC, outer membrane protein involved in starch binding |
|
|
SusC, outer membrane protein involved in starch binding |
| susD |
Gene: BACCELL_05445: SusD, outer membrane protein |
Gene: BACCOPRO_01927: SusD, outer membrane protein |
Gene: BACDOR_02277: SusD, outer membrane protein |
Gene: BACEGG_01901: SusD, outer membrane protein |
|
Gene: BACOVA_03517: SusD, outer membrane protein |
Gene: BACPLE_02369: SusD, outer membrane protein |
Gene: BACSTE_01658: SusD, outer membrane protein |
Gene: BT3701: SusD, outer membrane protein |
|
|
SusD, outer membrane protein |
| SusE |
Gene: BACCELL_05444: Outer membrane protein SusE |
|
Gene: BACDOR_02276: Outer membrane protein SusE |
Gene: BACEGG_01902: Outer membrane protein SusE |
|
Gene: BACOVA_03516: Outer membrane protein SusE |
Gene: BACPLE_02368: Outer membrane protein SusE |
Gene: BACSTE_01659: Outer membrane protein SusE |
Gene: BT3700: Outer membrane protein SusE |
|
|
Outer membrane protein SusE |
| susF |
Gene: BACCELL_05443: Outer membrane protein SusF |
|
Gene: BACDOR_02275: Outer membrane protein SusF |
|
|
Gene: BACOVA_03515: Outer membrane protein SusF |
|
Gene: BACSTE_01660: Outer membrane protein SusF |
Gene: BT3699: Outer membrane protein SusF |
|
|
Outer membrane protein SusF |
| COG3867 |
Gene: BACCELL_05442: Arabinogalactan endo-1,4-beta-galactosidase |
|
|
|
|
|
|
|
|
|
|
Arabinogalactan endo-1,4-beta-galactosidase |
| PF00128 |
Gene: BACCELL_05441: Glycosyl hydrolase, family 13, catalytic domain |
|
|
|
|
|
|
|
|
|
|
Glycosyl hydrolase, family 13, catalytic domain |
| susG |
|
|
Gene: BACDOR_02274: Alpha-amylase SusG (EC 3.2.1.1) |
Gene: BACEGG_01903: Alpha-amylase SusG (EC 3.2.1.1) |
|
Gene: BACOVA_03514: Alpha-amylase SusG (EC 3.2.1.1) |
|
Gene: BACSTE_01661: Alpha-amylase SusG (EC 3.2.1.1) |
Gene: BT3698: Alpha-amylase SusG (EC 3.2.1.1) |
|
|
Alpha-amylase SusG (EC 3.2.1.1) |
| CRON 4. | ||||||||||||
| susC |
|
|
|
|
*
Bacteroides fragilis NCTC 9343 Site: position = -172 score = 5.56417 sequence = TGATGCAATCGTTTGCGGAG Gene: BF3146: TonB-dependent outer membrane transporter of maltooligosaccharides |
|
|
|
|
*
Bacteroides uniformis ATCC 8492 Site: position = -191 score = 5.62697 sequence = GCATGCAATCGTTTGCACTG Gene: BACUNI_01209: TonB-dependent outer membrane transporter of maltooligosaccharides |
|
TonB-dependent outer membrane transporter of maltooligosaccharides |
| susD |
|
|
|
|
Gene: BF3145: SusD, outer membrane protein |
|
|
|
|
Gene: BACUNI_01211: SusD, outer membrane protein |
|
SusD, outer membrane protein |
| BF3144 |
|
|
|
|
Gene: BF3144: hypothetical protein |
|
|
|
|
Gene: BACUNI_01212: hypothetical protein |
|
hypothetical protein |
| glgB |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -105 score = 5.79827 sequence = TCATGCAACCGTTTGCATTA Gene: BACCELL_05433: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
|
|
|
Gene: BF3143: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
|
|
|
|
*
Bacteroides uniformis ATCC 8492 Site: position = -108 score = 5.73018 sequence = ATATGCAAACGTTTTCGTGA Gene: BACUNI_01214: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
|
1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
| COG3408 |
Gene: BACCELL_05432: Glycogen debranching enzyme |
|
|
|
|
|
|
|
|
|
|
Glycogen debranching enzyme |
| CRON 5. | ||||||||||||
| glgP |
|
Gene: BACCOPRO_01112: Glycogen phosphorylase (EC 2.4.1.1) |
Gene: BACDOR_02462: Glycogen phosphorylase (EC 2.4.1.1) |
*
Bacteroides eggerthii DSM 20697 Site: position = -115 score = 5.7679 sequence = TTATGCAAACGATTGTATAT Gene: BACEGG_02870: Glycogen phosphorylase (EC 2.4.1.1) |
Gene: BF2742: Glycogen phosphorylase (EC 2.4.1.1) |
Gene: BACOVA_00079: Glycogen phosphorylase (EC 2.4.1.1) |
Gene: BACPLE_01353: Glycogen phosphorylase (EC 2.4.1.1) |
*
Bacteroides stercoris ATCC 43183 Site: position = -115 score = 5.48594 sequence = TTATGCAAACGATTGTTTAT Gene: BACSTE_02867: Glycogen phosphorylase (EC 2.4.1.1) |
Gene: BT1294: Glycogen phosphorylase (EC 2.4.1.1) |
*
Bacteroides uniformis ATCC 8492 Site: position = -116 score = 5.11245 sequence = TTCCGCAAACGATTGTTTAT Gene: BACUNI_01811: Glycogen phosphorylase (EC 2.4.1.1) |
Gene: BVU_3560: Glycogen phosphorylase (EC 2.4.1.1) |
Glycogen phosphorylase (EC 2.4.1.1) |
| gys |
Gene: BACCELL_04113: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BACCOPRO_01111: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BACDOR_02463: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BACEGG_02869: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BF2741: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BACOVA_00080: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BACPLE_01354: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BACSTE_02866: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BT1293: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BACUNI_01812: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Gene: BVU_3559: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11) |
| CRON 6. | ||||||||||||
| PF02278 |
|
|
|
|
|
|
|
*
Bacteroides stercoris ATCC 43183 Site: position = -115 score = 5.8792 sequence = TTGTGCAAACGATTGCATGT Gene: BACSTE_01652: Polysaccharide lyase family 8, central domain |
|
|
|
Polysaccharide lyase family 8, central domain |
| bgaA |
Gene: BACCELL_05451: Arabinogalactan endo-1,4-beta-galactosidase |
|
|
|
|
Gene: BACOVA_05488: Arabinogalactan endo-1,4-beta-galactosidase |
|
Gene: BACSTE_01653: Arabinogalactan endo-1,4-beta-galactosidase |
Gene: BT4668: Arabinogalactan endo-1,4-beta-galactosidase |
*
Bacteroides uniformis ATCC 8492 Site: position = -78 score = 5.71455 sequence = TTGTGCAAACGATTGCGGAC Gene: BACUNI_01204: Arabinogalactan endo-1,4-beta-galactosidase |
|
Arabinogalactan endo-1,4-beta-galactosidase |
| BoGH2A |
Gene: BACCELL_05450: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
|
Gene: BACOVA_05487: Beta-galactosidase (EC 3.2.1.23) |
|
Gene: BACSTE_01654: Beta-galactosidase (EC 3.2.1.23) |
Gene: BT4667: Beta-galactosidase (EC 3.2.1.23) |
Gene: BACUNI_01205: Beta-galactosidase (EC 3.2.1.23) |
|
Beta-galactosidase (EC 3.2.1.23) |
| CRON 7. | ||||||||||||
| dpe |
Gene: BACCELL_00910: 4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25) |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -121 score = 5.70713 sequence = AAGAGCAAACGTTTGCATAG Gene: BACEGG_00187: 4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25) |
|
|
|
*
Bacteroides stercoris ATCC 43183 Site: position = -121 score = 5.29931 sequence = AAGCACAAACGTTTGCATAG Gene: BACSTE_03243: 4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25) |
|
|
|
4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25) |
| BACEGG_00186 |
|
|
|
Gene: BACEGG_00186: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| CRON 8. | ||||||||||||
| malR |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -2 score = 5.61535 sequence = GTTTGCAAACGTTTGCGCAA Gene: BACCELL_05464: Predicted maltose-responsive transcriptional regulator, LacI family |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -322 score = 5.42881 sequence = GAGCGCAAACGATTGCATCA Site: position = -169 score = 5.61926 sequence = TCCTGCAATCGTTTGCACTT Gene: BACEGG_01899: Predicted maltose-responsive transcriptional regulator, LacI family |
*
Bacteroides fragilis NCTC 9343 Site: position = -163 score = 5.56417 sequence = CTCCGCAAACGATTGCATCA Gene: BF3147: Predicted maltose-responsive transcriptional regulator, LacI family |
|
|
*
Bacteroides stercoris ATCC 43183 Site: position = -404 score = 5.8792 sequence = ACATGCAATCGTTTGCACAA Gene: BACSTE_01650: Predicted maltose-responsive transcriptional regulator, LacI family |
|
*
Bacteroides uniformis ATCC 8492 Site: position = -127 score = 5.71455 sequence = GTCCGCAATCGTTTGCACAA Gene: BACUNI_01203: Predicted maltose-responsive transcriptional regulator, LacI family |
|
Predicted maltose-responsive transcriptional regulator, LacI family |
| malP |
Gene: BACCELL_05465: Predicted maltose transporter, GPH family |
|
Gene: BACDOR_02293: Predicted maltose transporter, GPH family |
Gene: BACEGG_01898: Predicted maltose transporter, GPH family |
Gene: BF3148: Predicted maltose transporter, GPH family |
|
|
Gene: BACSTE_01649: Predicted maltose transporter, GPH family |
|
Gene: BACUNI_01202: Predicted maltose transporter, GPH family |
Gene: BVU_1386: Predicted maltose transporter, GPH family |
Predicted maltose transporter, GPH family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |