Regulon of MalR in Bacteroides stercoris ATCC 43183

Properties
Regulator type:	Transcription factor
TF locus tag:	BACSTE_01650
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:	Maltose
Regulog:	MalR - Bacteroidaceae
Statistics of regulated genes:
- Genes	15
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -190 Score: 5.9 Sequence: TAGTGCAATCGTTTGCATTC Locus tag: BACSTE_01657 Name: susC Funciton: SusC, outer membrane protein involved in starch binding Locus tag: BACSTE_01658 Name: susD Funciton: SusD, outer membrane protein Locus tag: BACSTE_01659 Name: SusE Funciton: Outer membrane protein SusE Locus tag: BACSTE_01660 Name: susF Funciton: Outer membrane protein SusF Locus tag: BACSTE_01661 Name: susG Funciton: Alpha-amylase SusG (EC 3.2.1.1)
	BACSTE_01657	susC	SusC, outer membrane protein involved in starch binding
	BACSTE_01658	susD	SusD, outer membrane protein
	BACSTE_01659	SusE	Outer membrane protein SusE
	BACSTE_01660	susF	Outer membrane protein SusF
	BACSTE_01661	susG	Alpha-amylase SusG (EC 3.2.1.1)
Position: -107 Score: 5.9 Sequence: CAGTGAAAACGTTTGCATAA Locus tag: BACSTE_00961 Name: susA Funciton: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135)
	BACSTE_00961	susA	Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135)
Position: -121 Score: 5.3 Sequence: AAGCACAAACGTTTGCATAG Locus tag: BACSTE_03243 Name: dpe Funciton: 4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25)
	BACSTE_03243	dpe	4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25)
Position: -404 Score: 5.9 Sequence: ACATGCAATCGTTTGCACAA Locus tag: BACSTE_01650 Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family Locus tag: BACSTE_01649 Name: malP Funciton: Predicted maltose transporter, GPH family
	BACSTE_01650	malR	Predicted maltose-responsive transcriptional regulator, LacI family
	BACSTE_01649	malP	Predicted maltose transporter, GPH family
Position: -115 Score: 5.9 Sequence: TTGTGCAAACGATTGCATGT Locus tag: BACSTE_01652 Name: PF02278 Funciton: Polysaccharide lyase family 8, central domain Locus tag: BACSTE_01653 Name: bgaA Funciton: Arabinogalactan endo-1,4-beta-galactosidase Locus tag: BACSTE_01654 Name: BoGH2A Funciton: Beta-galactosidase (EC 3.2.1.23)
	BACSTE_01652	PF02278	Polysaccharide lyase family 8, central domain
	BACSTE_01653	bgaA	Arabinogalactan endo-1,4-beta-galactosidase
	BACSTE_01654	BoGH2A	Beta-galactosidase (EC 3.2.1.23)
Position: -115 Score: 5.5 Sequence: TTATGCAAACGATTGTTTAT Locus tag: BACSTE_02867 Name: glgP Funciton: Glycogen phosphorylase (EC 2.4.1.1) Locus tag: BACSTE_02866 Name: gys Funciton: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11)
	BACSTE_02867	glgP	Glycogen phosphorylase (EC 2.4.1.1)
	BACSTE_02866	gys	Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11)
Position: -104 Score: 6 Sequence: TTATGCAAACGTTTGCTTTT Locus tag: BACSTE_00969 Name: susB Funciton: Alpha-glucosidase SusB (EC 3.2.1.20)
	BACSTE_00969	susB	Alpha-glucosidase SusB (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of MalR in Bacteroides stercoris ATCC 43183

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --