Regulon of MalR in Bacteroides fragilis NCTC 9343

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:	Maltose
Regulog:	MalR - Bacteroidaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -172 Score: 5.6 Sequence: TGATGCAATCGTTTGCGGAG Locus tag: BF3146 Name: susC Funciton: TonB-dependent outer membrane transporter of maltooligosaccharides Locus tag: BF3145 Name: susD Funciton: SusD, outer membrane protein Locus tag: BF3144 Name: BF3144 Funciton: hypothetical protein Locus tag: BF3143 Name: glgB Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
	BF3146	susC	TonB-dependent outer membrane transporter of maltooligosaccharides
	BF3145	susD	SusD, outer membrane protein
	BF3144	BF3144	hypothetical protein
	BF3143	glgB	1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
Position: -108 Score: 6.1 Sequence: CAATGAAAACGTTTGCATAA Locus tag: BF3134 Name: susA Funciton: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135)
	BF3134	susA	Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135)
Position: -163 Score: 5.6 Sequence: CTCCGCAAACGATTGCATCA Locus tag: BF3147 Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family Locus tag: BF3148 Name: malP Funciton: Predicted maltose transporter, GPH family
	BF3147	malR	Predicted maltose-responsive transcriptional regulator, LacI family
	BF3148	malP	Predicted maltose transporter, GPH family
Position: -100 Score: 5.7 Sequence: TTATGCAAACGTTTTCTGAT Locus tag: BF1158 Name: susB Funciton: Alpha-glucosidase SusB (EC 3.2.1.20)
	BF1158	susB	Alpha-glucosidase SusB (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD