Regulon of MalR in Bacteroides cellulosilyticus DSM 14838

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCELL_05464
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:	Maltose
Regulog:	MalR - Bacteroidaceae
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -184 Score: 5.7 Sequence: CTGTGCAATCGTTTGCACTG Locus tag: BACCELL_05446 Name: susC Funciton: SusC, outer membrane protein involved in starch binding Locus tag: BACCELL_05445 Name: susD Funciton: SusD, outer membrane protein Locus tag: BACCELL_05444 Name: SusE Funciton: Outer membrane protein SusE Locus tag: BACCELL_05443 Name: susF Funciton: Outer membrane protein SusF Locus tag: BACCELL_05442 Name: COG3867 Funciton: Arabinogalactan endo-1,4-beta-galactosidase Locus tag: BACCELL_05441 Name: PF00128 Funciton: Glycosyl hydrolase, family 13, catalytic domain
	BACCELL_05446	susC	SusC, outer membrane protein involved in starch binding
	BACCELL_05445	susD	SusD, outer membrane protein
	BACCELL_05444	SusE	Outer membrane protein SusE
	BACCELL_05443	susF	Outer membrane protein SusF
	BACCELL_05442	COG3867	Arabinogalactan endo-1,4-beta-galactosidase
	BACCELL_05441	PF00128	Glycosyl hydrolase, family 13, catalytic domain
Position: -114 Score: 5.7 Sequence: TTATGCAAACGTTTGCCGGT Locus tag: BACCELL_03487 Name: susB Funciton: Alpha-glucosidase SusB (EC 3.2.1.20)
	BACCELL_03487	susB	Alpha-glucosidase SusB (EC 3.2.1.20)
Position: -2 Score: 5.6 Sequence: GTTTGCAAACGTTTGCGCAA Locus tag: BACCELL_05464 Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family Locus tag: BACCELL_05465 Name: malP Funciton: Predicted maltose transporter, GPH family
	BACCELL_05464	malR	Predicted maltose-responsive transcriptional regulator, LacI family
	BACCELL_05465	malP	Predicted maltose transporter, GPH family
Position: -105 Score: 5.8 Sequence: TCATGCAACCGTTTGCATTA Locus tag: BACCELL_05433 Name: glgB Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) Locus tag: BACCELL_05432 Name: COG3408 Funciton: Glycogen debranching enzyme
	BACCELL_05433	glgB	1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
	BACCELL_05432	COG3408	Glycogen debranching enzyme

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD