Regulon of MalR in Bacteroides eggerthii DSM 20697

Properties
Regulator type:	Transcription factor
TF locus tag:	BACEGG_01899
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:	Maltose
Regulog:	MalR - Bacteroidaceae
Statistics of regulated genes:
- Genes	12
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -351 Score: 5.6 Sequence: AAGTGCAAACGATTGCAGGA Position: -198 Score: 5.4 Sequence: TGATGCAATCGTTTGCGCTC Locus tag: BACEGG_01900 Name: susC Funciton: SusC, outer membrane protein involved in starch binding Locus tag: BACEGG_01901 Name: susD Funciton: SusD, outer membrane protein Locus tag: BACEGG_01902 Name: SusE Funciton: Outer membrane protein SusE Locus tag: BACEGG_01903 Name: susG Funciton: Alpha-amylase SusG (EC 3.2.1.1)
	BACEGG_01900	susC	SusC, outer membrane protein involved in starch binding
	BACEGG_01901	susD	SusD, outer membrane protein
	BACEGG_01902	SusE	Outer membrane protein SusE
	BACEGG_01903	susG	Alpha-amylase SusG (EC 3.2.1.1)
Position: -107 Score: 5.8 Sequence: GCCTGAAAACGTTTGCATAA Locus tag: BACEGG_01490 Name: susA Funciton: Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135)
	BACEGG_01490	susA	Alpha-amylase (Neopullulanase) SusA (EC 3.2.1.135)
Position: -322 Score: 5.4 Sequence: GAGCGCAAACGATTGCATCA Position: -169 Score: 5.6 Sequence: TCCTGCAATCGTTTGCACTT Locus tag: BACEGG_01899 Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family Locus tag: BACEGG_01898 Name: malP Funciton: Predicted maltose transporter, GPH family
	BACEGG_01899	malR	Predicted maltose-responsive transcriptional regulator, LacI family
	BACEGG_01898	malP	Predicted maltose transporter, GPH family
Position: -121 Score: 5.7 Sequence: AAGAGCAAACGTTTGCATAG Locus tag: BACEGG_00187 Name: dpe Funciton: 4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25) Locus tag: BACEGG_00186 Name: null Funciton: hypothetical protein
	BACEGG_00187	dpe	4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25)
	BACEGG_00186		hypothetical protein
Position: -115 Score: 5.8 Sequence: TTATGCAAACGATTGTATAT Locus tag: BACEGG_02870 Name: glgP Funciton: Glycogen phosphorylase (EC 2.4.1.1) Locus tag: BACEGG_02869 Name: gys Funciton: Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11)
	BACEGG_02870	glgP	Glycogen phosphorylase (EC 2.4.1.1)
	BACEGG_02869	gys	Glycogen [starch] synthase, eukaryotic (EC 2.4.1.11)
Position: -109 Score: 5.7 Sequence: TTATGCAAACGTTTTCTGAC Locus tag: BACEGG_01482 Name: susB Funciton: Alpha-glucosidase SusB (EC 3.2.1.20)
	BACEGG_01482	susB	Alpha-glucosidase SusB (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD