Regulog IscR - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | 6 | 2 |
| Clostridium beijerincki NCIMB 8052 | 5 | 2 |
| Clostridium botulinum A str. ATCC 3502 | 3 | 1 |
| Clostridium butyricum 5521 | 4 | 1 |
| Clostridium kluyveri DSM 555 | 8 | 2 |
| Clostridium novyi NT | 4 | 1 |
| Clostridium perfringens ATCC 13124 | 8 | 4 |
| Clostridium tetani E88 | 4 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| hesB |
|
|
|
|
|
|
*
Clostridium perfringens ATCC 13124 Site: position = -76 score = 4.76628 sequence = TTTATTTTGTTTAAAATTATATAATTTAA Site: position = -101 score = 5.28721 sequence = TAAATTCCTACTAAAATAGTCTTGATTTA Gene: CPF_0654: HesB family protein |
|
HesB family protein |
| CRON 2. | |||||||||
| yxeON |
|
|
|
|
|
|
*
Clostridium perfringens ATCC 13124 Site: position = -69 score = 5.34994 sequence = TCAAAGTTGACAATTTTGATGGGAATTAA Gene: CPF_2350: Cysteine ABC transporter, substrate-binding protein fused to permease component |
|
Cysteine ABC transporter, substrate-binding protein fused to permease component |
| yxeM |
|
|
|
|
|
|
Gene: CPF_2349: Amino acid ABC transporter, ATP-binding protein |
|
Amino acid ABC transporter, ATP-binding protein |
| CRON 3. | |||||||||
| ldh |
Gene: CAC0267: L-lactate dehydrogenase (EC 1.1.1.27) |
Gene: Cbei_1014: L-lactate dehydrogenase (EC 1.1.1.27) |
Gene: CBO1519: L-lactate dehydrogenase (EC 1.1.1.27) |
Gene: CBY_2757: L-lactate dehydrogenase (EC 1.1.1.27) |
Gene: CKL_1381: L-lactate dehydrogenase (EC 1.1.1.27) |
Gene: NT01CX_0236: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Clostridium perfringens ATCC 13124 Site: position = -46 score = 5.54367 sequence = ATAATTCAGAGTAATTAACTAGGAATTAG Gene: CPF_0098: L-lactate dehydrogenase (EC 1.1.1.27) |
Gene: CTC01998: L-lactate dehydrogenase (EC 1.1.1.27) |
L-lactate dehydrogenase (EC 1.1.1.27) |
| CRON 4. | |||||||||
| sufC |
*
Clostridium acetobutylicum ATCC 824 Site: position = -58 score = 5.41844 sequence = TGAATTCCGACTTAAATGGTCAAGATTAA Gene: CAC3288: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Cbei_1848: Iron-sulfur cluster assembly ATPase protein SufC |
|
|
*
Clostridium kluyveri DSM 555 Site: position = -41 score = 5.71541 sequence = TTAAATATGAGTCAAATACTCGGATTTAA Gene: CKL_0828: Iron-sulfur cluster assembly ATPase protein SufC |
|
|
|
Iron-sulfur cluster assembly ATPase protein SufC |
| sufB |
Gene: CAC3289: Iron-sulfur cluster assembly protein SufB |
Gene: Cbei_1849: Iron-sulfur cluster assembly protein SufB |
|
|
Gene: CKL_0829: Iron-sulfur cluster assembly protein SufB |
|
|
|
Iron-sulfur cluster assembly protein SufB |
| sufD |
Gene: CAC3290: Iron-sulfur cluster assembly protein SufD |
Gene: Cbei_1850: Iron-sulfur cluster assembly protein SufD |
|
|
Gene: CKL_0830: Iron-sulfur cluster assembly protein SufD |
|
|
|
Iron-sulfur cluster assembly protein SufD |
| sufS |
Gene: CAC3291: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Cbei_1851: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
|
|
Gene: CKL_0831: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
|
|
|
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
| sufE |
Gene: CAC3292: Putative iron-sulfur cluster assembly scaffold protein for SUF system |
Gene: Cbei_1852: Putative iron-sulfur cluster assembly scaffold protein for SUF system |
|
|
Gene: CKL_0832: Putative iron-sulfur cluster assembly scaffold protein for SUF system |
|
|
|
Putative iron-sulfur cluster assembly scaffold protein for SUF system |
| CRON 5. | |||||||||
| cysK |
|
*
Clostridium beijerincki NCIMB 8052 Site: position = -55 score = 5.18973 sequence = TTATAACATAGTAAACTGATAAGAATTAT Gene: Cbei_4356: Cysteine synthase (EC 2.5.1.47) |
|
|
|
|
|
|
Cysteine synthase (EC 2.5.1.47) |
| CRON 6. | |||||||||
| iscR |
*
Clostridium acetobutylicum ATCC 824 Site: position = -41 score = 5.77827 sequence = ACAAAGTAGAGTATTATTGTCGGAATTAA Gene: CAC1675: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium beijerincki NCIMB 8052 Site: position = -105 score = 5.67628 sequence = CAAAAGCCGAGTATTTTGGTAAGATATAA Gene: Cbei_1097: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium botulinum A str. ATCC 3502 Site: position = -43 score = 6.02153 sequence = ATAAATCATAGTAAAGTGGTCAACATTAA Site: position = -82 score = 4.78731 sequence = ATATTGTTGACAGGTTTAGTCTGATTTGC Gene: CBO2569: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium butyricum 5521 Site: position = -61 score = 5.25534 sequence = CAATAGCCGAGTATTTTGATAAGATATAA Gene: CBY_2622: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium kluyveri DSM 555 Site: position = -71 score = 5.76577 sequence = TTATTGTTGACAAGTTTACTCTGATTTGA Gene: CKL_1317: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium novyi NT Site: position = -41 score = 5.60115 sequence = AGAATTCATAGTATAACACTCGGATTTAA Site: position = -82 score = 5.91078 sequence = TTAATGTTGACAAAAACACTCGGATTTGA Gene: NT01CX_2284: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium perfringens ATCC 13124 Site: position = -80 score = 5.82798 sequence = TTATTGTTGACAAATTTACTCGGTTTTGA Site: position = -39 score = 5.03984 sequence = ATAAAGTACATCGAATTAGTCAGATTTAG Gene: CPF_2040: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium tetani E88 Site: position = -52 score = 5.49248 sequence = TGAAAGTTTAGTAAAGCAGTAGACTTTCA Site: position = -92 score = 5.21816 sequence = TTATAGTTGACAGGAATACTCGGATTTGT Gene: CTC01049: Iron-sulfur cluster assembly transcription factor IscR |
Iron-sulfur cluster assembly transcription factor IscR |
| iscS |
|
Gene: Cbei_1098: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CBO2568: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CBY_2621: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CKL_1318: Cysteine desulfurase (EC 2.8.1.7) |
Gene: NT01CX_2283: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CPF_2039: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CTC01050: Cysteine desulfurase (EC 2.8.1.7) |
Cysteine desulfurase (EC 2.8.1.7) |
| iscU |
|
Gene: Cbei_1099: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CBO2567: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CBY_2620: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CKL_1319: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: NT01CX_2282: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CPF_2038: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CTC01051: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
| trmU |
|
Gene: Cbei_1100: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CBO2905: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CBY_2619: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CKL_1088: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: NT01CX_2281: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CPF_2037: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CTC01052: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |