Regulon of IscR in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_1097
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Clostridia-1
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 5.7 Sequence: CAAAAGCCGAGTATTTTGGTAAGATATAA Locus tag: Cbei_1097 Name: iscR Funciton: Iron-sulfur cluster assembly transcription factor IscR Locus tag: Cbei_1098 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: Cbei_1099 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like Locus tag: Cbei_1100 Name: trmU Funciton: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
	Cbei_1097	iscR	Iron-sulfur cluster assembly transcription factor IscR
	Cbei_1098	iscS	Cysteine desulfurase (EC 2.8.1.7)
	Cbei_1099	iscU	Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
	Cbei_1100	trmU	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
Position: -55 Score: 5.2 Sequence: TTATAACATAGTAAACTGATAAGAATTAT Locus tag: Cbei_4356 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	Cbei_4356	cysK	Cysteine synthase (EC 2.5.1.47)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD