Regulon of IscR in Clostridium perfringens ATCC 13124

Properties
Regulator type:	Transcription factor
TF locus tag:	CPF_2040
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Clostridia-1
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 5.8 Sequence: TTATTGTTGACAAATTTACTCGGTTTTGA Position: -39 Score: 5 Sequence: ATAAAGTACATCGAATTAGTCAGATTTAG Locus tag: CPF_2040 Name: iscR Funciton: Iron-sulfur cluster assembly transcription factor IscR Locus tag: CPF_2039 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: CPF_2038 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like Locus tag: CPF_2037 Name: trmU Funciton: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
	CPF_2040	iscR	Iron-sulfur cluster assembly transcription factor IscR
	CPF_2039	iscS	Cysteine desulfurase (EC 2.8.1.7)
	CPF_2038	iscU	Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
	CPF_2037	trmU	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
Position: -46 Score: 5.5 Sequence: ATAATTCAGAGTAATTAACTAGGAATTAG Locus tag: CPF_0098 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
	CPF_0098	ldh	L-lactate dehydrogenase (EC 1.1.1.27)
Position: -101 Score: 5.3 Sequence: TAAATTCCTACTAAAATAGTCTTGATTTA Position: -76 Score: 4.8 Sequence: TTTATTTTGTTTAAAATTATATAATTTAA Locus tag: CPF_0654 Name: hesB Funciton: HesB family protein
	CPF_0654	hesB	HesB family protein
Position: -69 Score: 5.3 Sequence: TCAAAGTTGACAATTTTGATGGGAATTAA Locus tag: CPF_2350 Name: yxeON Funciton: Cysteine ABC transporter, substrate-binding protein fused to permease component Locus tag: CPF_2349 Name: yxeM Funciton: Amino acid ABC transporter, ATP-binding protein
	CPF_2350	yxeON	Cysteine ABC transporter, substrate-binding protein fused to permease component
	CPF_2349	yxeM	Amino acid ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD