Orthologous regulated operons containing yxeON gene

Properties
Regulog:	IscR - Clostridia-1
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Firmicutes

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Clostridium perfringens ATCC 13124
Position: -69 Score: 5.34994 Sequence: TCAAAGTTGACAATTTTGATGGGAATTAA Locus tag: CPF_2350 Name: yxeON Funciton: Cysteine ABC transporter, substrate-binding protein fused to permease component Locus tag: CPF_2349 Name: yxeM Funciton: Amino acid ABC transporter, ATP-binding protein
yxeON-yxeM	-69	5.3	TCAAAGTTGACAATTTTGATGGGAATTAA	CPF_2350

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --