Regulog Phr - Methanosarcinales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | |
| Phylum: | Euryarchaeota |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Methanosarcinales
- By trascription factor - Phr
- By TF family - ArsR
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Methanococcoides burtonii DSM 6242 | ||
| Methanohalophilus mahii DSM 5219 | ||
| Methanosaeta thermophila PT | 2 | 1 |
| Methanosarcina acetivorans C2A | 4 | 1 |
| Methanosarcina barkeri str. fusaro | 4 | 1 |
| Methanosarcina mazei Goe1 | 4 | 1 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| phr |
|
|
*
Methanosaeta thermophila PT Site: position = -56 score = 5.52978 sequence = ATATCTAACTTTTTGTTACTAAC Site: position = -42 score = 4.99456 sequence = GTTACTAACCATCAGTTATGATT Gene: Mthe_0612: Heat shock response regulator Phr, ArsR family |
*
Methanosarcina acetivorans C2A Site: position = -315 score = 6.21732 sequence = ATTGCTAACTAATGGTTACTAAC Gene: MA4576: Heat shock response regulator Phr, ArsR family |
*
Methanosarcina barkeri str. fusaro Site: position = -189 score = 5.90585 sequence = GATGCTAACTATAGGTTACTATC Gene: Mbar_A0909: Heat shock response regulator Phr, ArsR family |
*
Methanosarcina mazei Goe1 Site: position = -299 score = 5.74626 sequence = ACCGCTAACTAATGGTTACTAAC Gene: MM1257: Heat shock response regulator Phr, ArsR family |
Heat shock response regulator Phr, ArsR family |
| vat |
Gene: Mbur_1677: ATPase, AAA+ family |
|
Gene: Mthe_0613: ATPase, AAA+ family |
Gene: MA4575: ATPase, AAA+ family |
Gene: Mbar_A0908: ATPase, AAA+ family |
Gene: MM1256: ATPase, AAA+ family |
ATPase, AAA+ family |
| hsp20 |
|
|
|
Gene: MA4574: Small heat shock protein 20 |
Gene: Mbar_A0907: Small heat shock protein 20 |
Gene: MM1255: Small heat shock protein 20 |
Small heat shock protein 20 |
| hsp20 |
|
|
|
Gene: MA4573: Small heat shock protein 20 |
Gene: Mbar_A0906: Small heat shock protein 20 |
Gene: MM1254: Small heat shock protein 20 |
Small heat shock protein 20 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |