Statistics of regulated genes

Genome	Genes	Operons
Methanococcoides burtonii DSM 6242
Methanohalophilus mahii DSM 5219
Methanosaeta thermophila PT	2	1
Methanosarcina acetivorans C2A	4	1
Methanosarcina barkeri str. fusaro	4	1
Methanosarcina mazei Goe1	4	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes							Function
CRON 1.
phr	Methanococcoides burtonii DSM 6242	Methanohalophilus mahii DSM 5219	* Methanosaeta thermophila PT Site: position = -56 score = 5.52978 sequence = ATATCTAACTTTTTGTTACTAAC Site: position = -42 score = 4.99456 sequence = GTTACTAACCATCAGTTATGATT Gene: Mthe_0612: Heat shock response regulator Phr, ArsR family	* Methanosarcina acetivorans C2A Site: position = -315 score = 6.21732 sequence = ATTGCTAACTAATGGTTACTAAC Gene: MA4576: Heat shock response regulator Phr, ArsR family	* Methanosarcina barkeri str. fusaro Site: position = -189 score = 5.90585 sequence = GATGCTAACTATAGGTTACTATC Gene: Mbar_A0909: Heat shock response regulator Phr, ArsR family	* Methanosarcina mazei Goe1 Site: position = -299 score = 5.74626 sequence = ACCGCTAACTAATGGTTACTAAC Gene: MM1257: Heat shock response regulator Phr, ArsR family	Heat shock response regulator Phr, ArsR family
vat	Methanococcoides burtonii DSM 6242 Gene: Mbur_1677: ATPase, AAA+ family	Methanohalophilus mahii DSM 5219	Methanosaeta thermophila PT Gene: Mthe_0613: ATPase, AAA+ family	Methanosarcina acetivorans C2A Gene: MA4575: ATPase, AAA+ family	Methanosarcina barkeri str. fusaro Gene: Mbar_A0908: ATPase, AAA+ family	Methanosarcina mazei Goe1 Gene: MM1256: ATPase, AAA+ family	ATPase, AAA+ family
hsp20	Methanococcoides burtonii DSM 6242	Methanohalophilus mahii DSM 5219	Methanosaeta thermophila PT	Methanosarcina acetivorans C2A Gene: MA4574: Small heat shock protein 20	Methanosarcina barkeri str. fusaro Gene: Mbar_A0907: Small heat shock protein 20	Methanosarcina mazei Goe1 Gene: MM1255: Small heat shock protein 20	Small heat shock protein 20
hsp20	Methanococcoides burtonii DSM 6242	Methanohalophilus mahii DSM 5219	Methanosaeta thermophila PT	Methanosarcina acetivorans C2A Gene: MA4573: Small heat shock protein 20	Methanosarcina barkeri str. fusaro Gene: Mbar_A0906: Small heat shock protein 20	Methanosarcina mazei Goe1 Gene: MM1254: Small heat shock protein 20	Small heat shock protein 20

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD