Regulon of Phr in Methanosarcina acetivorans C2A

Properties
Regulator type:	Transcription factor
TF locus tag:	MA4576
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanosarcinales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Methanosarcinales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -315 Score: 6.2 Sequence: ATTGCTAACTAATGGTTACTAAC Locus tag: MA4576 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: MA4575 Name: vat Funciton: ATPase, AAA+ family Locus tag: MA4574 Name: hsp20 Funciton: Small heat shock protein 20 Locus tag: MA4573 Name: hsp20 Funciton: Small heat shock protein 20
	MA4576	phr	Heat shock response regulator Phr, ArsR family
	MA4575	vat	ATPase, AAA+ family
	MA4574	hsp20	Small heat shock protein 20
	MA4573	hsp20	Small heat shock protein 20

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD