Regulon of Phr in Methanosaeta thermophila PT

Properties
Regulator type:	Transcription factor
TF locus tag:	Mthe_0612
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanosarcinales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Methanosarcinales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5.5 Sequence: ATATCTAACTTTTTGTTACTAAC Position: -42 Score: 5 Sequence: GTTACTAACCATCAGTTATGATT Locus tag: Mthe_0612 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: Mthe_0613 Name: vat Funciton: ATPase, AAA+ family
	Mthe_0612	phr	Heat shock response regulator Phr, ArsR family
	Mthe_0613	vat	ATPase, AAA+ family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD