Regulog MtlR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | activator |
| Biological process: | Mannitol utilization |
| Effector: | MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - BglG
- By effector - MtlA, mannitol-specific enzyme IICB PTS component
- By effector - HPr, phosphocarrier protein
- By pathway - Mannitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 4 | 1 |
| Staphylococcus capitis SK14 | 4 | 1 |
| Staphylococcus epidermidis ATCC 12228 | ||
| Staphylococcus carnosus subsp. carnosus TM300 | 4 | 1 |
| Staphylococcus haemolyticus JCSC1435 | 4 | 1 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 4 | 1 |
| Macrococcus caseolyticus JCSC5402 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| mtlF |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -104 score = 6.47731 sequence = TTGTCACATTTATTTTGACAA Gene: SA1960: mannitol specific PTS system, IIBC component |
*
Staphylococcus capitis SK14 Site: position = -108 score = 6.1949 sequence = TTGTCACAAATATCATGACAA Gene: STACA0001_0858: mannitol specific PTS system, IIBC component |
|
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -105 score = 5.26619 sequence = ATGGCAACAATTCAGTGACAA Gene: Sca_1658: mannitol specific PTS system, IIBC component |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -105 score = 6.79543 sequence = TTGTCACAATTACTGTGACAA Gene: SH0235: mannitol specific PTS system, IIBC component |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -106 score = 6.57626 sequence = TTGTCAAAGATACTGTGACAA Gene: SSP0728: mannitol specific PTS system, IIBC component |
|
mannitol specific PTS system, IIBC component |
| mtlR |
Gene: SA1961: transcriptional activator of mannitol operon, BglG family |
Gene: STACA0001_0859: transcriptional activator of mannitol operon, BglG family |
|
Gene: Sca_1659: transcriptional activator of mannitol operon, BglG family |
Gene: SH0234: transcriptional activator of mannitol operon, BglG family |
Gene: SSP0727: transcriptional activator of mannitol operon, BglG family |
|
transcriptional activator of mannitol operon, BglG family |
| mtlA |
Gene: SA1962: mannitol specific PTS system, IIA component |
Gene: STACA0001_0860: mannitol specific PTS system, IIA component |
|
Gene: Sca_1660: mannitol specific PTS system, IIA component |
Gene: SH0233: mannitol specific PTS system, IIA component |
Gene: SSP0726: mannitol specific PTS system, IIA component |
|
mannitol specific PTS system, IIA component |
| mtlD |
Gene: SA1963: mannitol-1-phosphate 5-dehydrogenase |
Gene: STACA0001_0861: mannitol-1-phosphate 5-dehydrogenase |
|
Gene: Sca_1661: mannitol-1-phosphate 5-dehydrogenase |
Gene: SH0232: mannitol-1-phosphate 5-dehydrogenase |
Gene: SSP0725: mannitol-1-phosphate 5-dehydrogenase |
|
mannitol-1-phosphate 5-dehydrogenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |