Regulon of MtlR in Staphylococcus capitis SK14
| Regulator type: | Transcription factor |
| TF locus tag: | STACA0001_0859 |
| Regulator family: | BglG |
| Regulation mode: | activator |
| Biological process: | Mannitol utilization |
| Effector: | MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein |
| Regulog: | MtlR - Staphylococcaceae |
| Statistics of regulated genes: | |
| - Genes | 4 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - BglG
- By effector - MtlA, mannitol-specific enzyme IICB PTS component
- By effector - HPr, phosphocarrier protein
- By pathway - Mannitol utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -108
Score: 6.2 Sequence: TTGTCACAAATATCATGACAA
Locus tag: STACA0001_0858
Name: mtlF Funciton: mannitol specific PTS system, IIBC component
Locus tag: STACA0001_0859
Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: STACA0001_0860
Name: mtlA Funciton: mannitol specific PTS system, IIA component
Locus tag: STACA0001_0861
Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase |
|||
|
mtlF
|
mannitol specific PTS system, IIBC component
|
||
|
mtlR
|
transcriptional activator of mannitol operon, BglG family
|
||
|
mtlA
|
mannitol specific PTS system, IIA component
|
||
|
mtlD
|
mannitol-1-phosphate 5-dehydrogenase
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |