Regulon of MtlR in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_0859
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Mannitol utilization
Effector:	MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Regulog:	MtlR - Staphylococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - BglG
By effector - MtlA, mannitol-specific enzyme IICB PTS component
By effector - HPr, phosphocarrier protein
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 6.2 Sequence: TTGTCACAAATATCATGACAA Locus tag: STACA0001_0858 Name: mtlF Funciton: mannitol specific PTS system, IIBC component Locus tag: STACA0001_0859 Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family Locus tag: STACA0001_0860 Name: mtlA Funciton: mannitol specific PTS system, IIA component Locus tag: STACA0001_0861 Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase
	STACA0001_0858	mtlF	mannitol specific PTS system, IIBC component
	STACA0001_0859	mtlR	transcriptional activator of mannitol operon, BglG family
	STACA0001_0860	mtlA	mannitol specific PTS system, IIA component
	STACA0001_0861	mtlD	mannitol-1-phosphate 5-dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD