Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mtlD gene

Properties
Regulog: MtlR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -104
Score: 6.47731
Sequence: TTGTCACATTTATTTTGACAA
Locus tag: SA1960
Name: mtlF
Funciton: mannitol specific PTS system, IIBC component
Locus tag: SA1961
Name: mtlR
Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SA1962
Name: mtlA
Funciton: mannitol specific PTS system, IIA component
Locus tag: SA1963
Name: mtlD
Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD -104 6.5 TTGTCACATTTATTTTGACAA SA1960
Staphylococcus capitis SK14
Position: -108
Score: 6.1949
Sequence: TTGTCACAAATATCATGACAA
Locus tag: STACA0001_0858
Name: mtlF
Funciton: mannitol specific PTS system, IIBC component
Locus tag: STACA0001_0859
Name: mtlR
Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: STACA0001_0860
Name: mtlA
Funciton: mannitol specific PTS system, IIA component
Locus tag: STACA0001_0861
Name: mtlD
Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD -108 6.2 TTGTCACAAATATCATGACAA STACA0001_0858
Staphylococcus carnosus subsp. carnosus TM300
Position: -105
Score: 5.26619
Sequence: ATGGCAACAATTCAGTGACAA
Locus tag: Sca_1658
Name: mtlF
Funciton: mannitol specific PTS system, IIBC component
Locus tag: Sca_1659
Name: mtlR
Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: Sca_1660
Name: mtlA
Funciton: mannitol specific PTS system, IIA component
Locus tag: Sca_1661
Name: mtlD
Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD -105 5.3 ATGGCAACAATTCAGTGACAA Sca_1658
Staphylococcus haemolyticus JCSC1435
Position: -105
Score: 6.79543
Sequence: TTGTCACAATTACTGTGACAA
Locus tag: SH0235
Name: mtlF
Funciton: mannitol specific PTS system, IIBC component
Locus tag: SH0234
Name: mtlR
Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SH0233
Name: mtlA
Funciton: mannitol specific PTS system, IIA component
Locus tag: SH0232
Name: mtlD
Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD -105 6.8 TTGTCACAATTACTGTGACAA SH0235
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -106
Score: 6.57626
Sequence: TTGTCAAAGATACTGTGACAA
Locus tag: SSP0728
Name: mtlF
Funciton: mannitol specific PTS system, IIBC component
Locus tag: SSP0727
Name: mtlR
Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SSP0726
Name: mtlA
Funciton: mannitol specific PTS system, IIA component
Locus tag: SSP0725
Name: mtlD
Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD -106 6.6 TTGTCAAAGATACTGTGACAA SSP0728