Regulon of MtlR in Staphylococcus haemolyticus JCSC1435
Regulator type: | Transcription factor |
TF locus tag: | SH0234 |
Regulator family: | BglG |
Regulation mode: | activator |
Biological process: | Mannitol utilization |
Effector: | MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein |
Regulog: | MtlR - Staphylococcaceae |
Statistics of regulated genes: | |
- Genes | 4 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - BglG
- By effector - MtlA, mannitol-specific enzyme IICB PTS component
- By effector - HPr, phosphocarrier protein
- By pathway - Mannitol utilization
Locus Tag | Name | Function | |
---|---|---|---|
Position: -105
Score: 6.8 Sequence: TTGTCACAATTACTGTGACAA
Locus tag: SH0235
Name: mtlF Funciton: mannitol specific PTS system, IIBC component
Locus tag: SH0234
Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SH0233
Name: mtlA Funciton: mannitol specific PTS system, IIA component
Locus tag: SH0232
Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase |
|||
mtlF
|
mannitol specific PTS system, IIBC component
|
||
mtlR
|
transcriptional activator of mannitol operon, BglG family
|
||
mtlA
|
mannitol specific PTS system, IIA component
|
||
mtlD
|
mannitol-1-phosphate 5-dehydrogenase
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |