Orthologous regulated operons containing mtlF gene

Properties
Regulog:	MtlR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Mannitol utilization
Effector:	MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Phylum:	Firmicutes

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -104 Score: 6.47731 Sequence: TTGTCACATTTATTTTGACAA Locus tag: SA1960 Name: mtlF Funciton: mannitol specific PTS system, IIBC component Locus tag: SA1961 Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family Locus tag: SA1962 Name: mtlA Funciton: mannitol specific PTS system, IIA component Locus tag: SA1963 Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD	-104	6.5	TTGTCACATTTATTTTGACAA	SA1960
Staphylococcus capitis SK14
Position: -108 Score: 6.1949 Sequence: TTGTCACAAATATCATGACAA Locus tag: STACA0001_0858 Name: mtlF Funciton: mannitol specific PTS system, IIBC component Locus tag: STACA0001_0859 Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family Locus tag: STACA0001_0860 Name: mtlA Funciton: mannitol specific PTS system, IIA component Locus tag: STACA0001_0861 Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD	-108	6.2	TTGTCACAAATATCATGACAA	STACA0001_0858
Staphylococcus carnosus subsp. carnosus TM300
Position: -105 Score: 5.26619 Sequence: ATGGCAACAATTCAGTGACAA Locus tag: Sca_1658 Name: mtlF Funciton: mannitol specific PTS system, IIBC component Locus tag: Sca_1659 Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family Locus tag: Sca_1660 Name: mtlA Funciton: mannitol specific PTS system, IIA component Locus tag: Sca_1661 Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD	-105	5.3	ATGGCAACAATTCAGTGACAA	Sca_1658
Staphylococcus haemolyticus JCSC1435
Position: -105 Score: 6.79543 Sequence: TTGTCACAATTACTGTGACAA Locus tag: SH0235 Name: mtlF Funciton: mannitol specific PTS system, IIBC component Locus tag: SH0234 Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family Locus tag: SH0233 Name: mtlA Funciton: mannitol specific PTS system, IIA component Locus tag: SH0232 Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD	-105	6.8	TTGTCACAATTACTGTGACAA	SH0235
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -106 Score: 6.57626 Sequence: TTGTCAAAGATACTGTGACAA Locus tag: SSP0728 Name: mtlF Funciton: mannitol specific PTS system, IIBC component Locus tag: SSP0727 Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family Locus tag: SSP0726 Name: mtlA Funciton: mannitol specific PTS system, IIA component Locus tag: SSP0725 Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF-mtlR-mtlA-mtlD	-106	6.6	TTGTCAAAGATACTGTGACAA	SSP0728