Regulog ThiR - Sulfolobales
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | repressor |
| Biological process: | Thiamine transport; Thiamine biosynthesis |
| Effector: | Thiamine phosphate |
| Phylum: | Crenarchaeota |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ThiR
- By taxonomy - Sulfolobales
- By TF family - [Other]
- By effector - Thiamine phosphate
- By pathway - Thiamine transport
- By pathway - Thiamine biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Metallosphaera sedula DSM 5348 | 2 | 2 |
| Sulfolobus acidocaldarius DSM 639 | 3 | 3 |
| Sulfolobus islandicus Y.N.15.51 | 3 | 3 |
| Sulfolobus solfataricus P2 | 3 | 3 |
| Sulfolobus tokodaii str. 7 | 2 | 2 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| thiC |
*
Metallosphaera sedula DSM 5348 Site: position = -18 score = 5.83544 sequence = CTTATAACTTACTTTATAAT Gene: Msed_0906: Thiamin biosynthesis protein ThiC |
*
Sulfolobus acidocaldarius DSM 639 Site: position = -30 score = 5.21345 sequence = TTTATAATCTAGTTTATTGA Gene: Saci_0137: Thiamin biosynthesis protein ThiC |
|
Gene: SSO1324: Thiamin biosynthesis protein ThiC |
Gene: ST1864: Thiamin biosynthesis protein ThiC |
Thiamin biosynthesis protein ThiC |
| CRON 2. | ||||||
| thiT |
Gene: Msed_0254: Predicted thiamin transporter ThiT |
*
Sulfolobus acidocaldarius DSM 639 Site: position = -42 score = 5.25491 sequence = AATATAACTAACTTTATAAC Gene: Saci_2110: Predicted thiamin transporter ThiT |
*
Sulfolobus islandicus Y.N.15.51 Site: position = -42 score = 5.28738 sequence = AAAATAAGTGACTTTATAAG Gene: YN1551_2514: Predicted thiamin transporter ThiT |
*
Sulfolobus solfataricus P2 Site: position = -42 score = 5.28738 sequence = AAAATAAGTGACTTTATAAG Gene: SSO1593: Predicted thiamin transporter ThiT |
*
Sulfolobus tokodaii str. 7 Site: position = -42 score = 5.57791 sequence = CATATAAGTAGGTTTATAAG Gene: ST1132: Predicted thiamin transporter ThiT |
Predicted thiamin transporter ThiT |
| CRON 3. | ||||||
| tenA |
|
Gene: Saci_2283: Thiaminase |
*
Sulfolobus islandicus Y.N.15.51 Site: position = -41 score = 5.47183 sequence = CTTATAAAATGATTTATAAT Gene: YN1551_2613: Thiaminase |
*
Sulfolobus solfataricus P2 Site: position = -41 score = 5.5992 sequence = GTTATAAAATAATTTATAAT Gene: SSO2089: Thiaminase |
|
Thiaminase |
| CRON 4. | ||||||
| thi4 |
*
Metallosphaera sedula DSM 5348 Site: position = -42 score = 6.073 sequence = TTTATAACTTAGTTTATAAG Gene: Msed_2221: Thiazole biosynthetic enzyme Thi4 |
*
Sulfolobus acidocaldarius DSM 639 Site: position = -38 score = 5.67163 sequence = CATATAAGTGAGTTTATAAC Gene: Saci_0854: Thiazole biosynthetic enzyme Thi4 |
*
Sulfolobus islandicus Y.N.15.51 Site: position = -41 score = 5.72907 sequence = TATAAAAGTTAATTTATAAG Gene: YN1551_1140: Thiazole biosynthetic enzyme Thi4 |
*
Sulfolobus solfataricus P2 Site: position = -41 score = 5.72907 sequence = TATAAAAGTTAATTTATAAG Gene: SSO0436: Thiazole biosynthetic enzyme Thi4 |
*
Sulfolobus tokodaii str. 7 Site: position = -31 score = 5.44723 sequence = TATATTAGCTAGTTTATAAT Gene: ST0361: Thiazole biosynthetic enzyme Thi4 |
Thiazole biosynthetic enzyme Thi4 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |