Regulon of ThiR in Sulfolobus solfataricus P2

Properties
Regulator type:	Transcription factor
TF locus tag:	SSO0468
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Thiamine transport; Thiamine biosynthesis
Effector:	Thiamine phosphate
Regulog:	ThiR - Sulfolobales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - ThiR
By taxonomy - Sulfolobales
By TF family - [Other]
By effector - Thiamine phosphate
By pathway - Thiamine transport
By pathway - Thiamine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 5.7 Sequence: TATAAAAGTTAATTTATAAG Locus tag: SSO0436 Name: thi4 Funciton: Thiazole biosynthetic enzyme Thi4
	SSO0436	thi4	Thiazole biosynthetic enzyme Thi4
Position: -41 Score: 5.6 Sequence: GTTATAAAATAATTTATAAT Locus tag: SSO2089 Name: tenA Funciton: Thiaminase
	SSO2089	tenA	Thiaminase
Position: -42 Score: 5.3 Sequence: AAAATAAGTGACTTTATAAG Locus tag: SSO1593 Name: thiT Funciton: Predicted thiamin transporter ThiT
	SSO1593	thiT	Predicted thiamin transporter ThiT

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD