Regulon of ThiR in Sulfolobus acidocaldarius DSM 639

Properties
Regulator type:	Transcription factor
TF locus tag:	Saci_0437
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Thiamine transport; Thiamine biosynthesis
Effector:	Thiamine phosphate
Regulog:	ThiR - Sulfolobales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - ThiR
By taxonomy - Sulfolobales
By TF family - [Other]
By effector - Thiamine phosphate
By pathway - Thiamine transport
By pathway - Thiamine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 5.7 Sequence: CATATAAGTGAGTTTATAAC Locus tag: Saci_0854 Name: thi4 Funciton: Thiazole biosynthetic enzyme Thi4
	Saci_0854	thi4	Thiazole biosynthetic enzyme Thi4
Position: -42 Score: 5.3 Sequence: AATATAACTAACTTTATAAC Locus tag: Saci_2110 Name: thiT Funciton: Predicted thiamin transporter ThiT
	Saci_2110	thiT	Predicted thiamin transporter ThiT
Position: -30 Score: 5.2 Sequence: TTTATAATCTAGTTTATTGA Locus tag: Saci_0137 Name: thiC Funciton: Thiamin biosynthesis protein ThiC
	Saci_0137	thiC	Thiamin biosynthesis protein ThiC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD