Regulon of ThiR in Metallosphaera sedula DSM 5348

Properties
Regulator type:	Transcription factor
TF locus tag:	Msed_2166
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Thiamine transport; Thiamine biosynthesis
Effector:	Thiamine phosphate
Regulog:	ThiR - Sulfolobales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - ThiR
By taxonomy - Sulfolobales
By TF family - [Other]
By effector - Thiamine phosphate
By pathway - Thiamine transport
By pathway - Thiamine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -18 Score: 5.8 Sequence: CTTATAACTTACTTTATAAT Locus tag: Msed_0906 Name: thiC Funciton: Thiamin biosynthesis protein ThiC
	Msed_0906	thiC	Thiamin biosynthesis protein ThiC
Position: -42 Score: 6.1 Sequence: TTTATAACTTAGTTTATAAG Locus tag: Msed_2221 Name: thi4 Funciton: Thiazole biosynthetic enzyme Thi4
	Msed_2221	thi4	Thiazole biosynthetic enzyme Thi4

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD