Regulog MalR - Staphylococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Statistics of regulated genes
Genome	Genes	Operons
Staphylococcus aureus subsp. aureus N315	9	2
Staphylococcus capitis SK14
Staphylococcus epidermidis ATCC 12228
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435	2	1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	2	1
Macrococcus caseolyticus JCSC5402	10	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
mdxE	Staphylococcus aureus subsp. aureus N315 Gene: SA0207: Maltose/maltodextrin ABC transporter, substrate binding protein	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	* Macrococcus caseolyticus JCSC5402 Site: position = -110 score = 6.66683 sequence = TTATGCAATCGTTTGCAAAA Gene: MCCL_0353: Maltose/maltodextrin ABC transporter, substrate binding protein	Maltose/maltodextrin ABC transporter, substrate binding protein
mdxF	Staphylococcus aureus subsp. aureus N315 Gene: SA0208: Maltose/maltodextrin ABC transporter, permease protein	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0354: Maltose/maltodextrin ABC transporter, permease protein	Maltose/maltodextrin ABC transporter, permease protein
mdxG	Staphylococcus aureus subsp. aureus N315 Gene: SA0209: Maltose/maltodextrin ABC transporter, permease protein	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0355: Maltose/maltodextrin ABC transporter, permease protein	Maltose/maltodextrin ABC transporter, permease protein
malR	* Staphylococcus aureus subsp. aureus N315 Site: position = -112 score = 6.90263 sequence = TTATGCAATCGTTTGCACAA Gene: SA1339: Maltose operon transcriptional repressor MalR, LacI family	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	* Staphylococcus haemolyticus JCSC1435 Site: position = -228 score = 6.55203 sequence = TTATGCAAACGATTGCATTA Gene: SH1407: Maltose operon transcriptional repressor MalR, LacI family	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -106 score = 6.42784 sequence = TCGCGCAAACGTTTGCACAA Gene: SSP1245: Maltose operon transcriptional repressor MalR, LacI family	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0356: Maltose operon transcriptional repressor MalR, LacI family	Maltose operon transcriptional repressor MalR, LacI family
MCCL_0357	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0357: trehalosemaltose utilization protein	trehalosemaltose utilization protein
gfoA	Staphylococcus aureus subsp. aureus N315 Gene: SA0210: putative glucose dehydrogenase A	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0358: putative glucose dehydrogenase A	putative glucose dehydrogenase A
gfoB	Staphylococcus aureus subsp. aureus N315 Gene: SA0211: putative glucose dehydrogenase B	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0359: putative glucose dehydrogenase B	putative glucose dehydrogenase B
gfoI	Staphylococcus aureus subsp. aureus N315 Gene: SA0212: putative sugar isomerase	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0360: putative sugar isomerase	putative sugar isomerase
mdxK	* Staphylococcus aureus subsp. aureus N315 Site: position = -66 score = 6.74219 sequence = TTGTGCAAACGTTTTCACAA Gene: SA0206: Maltose/maltodextrin transport ATP-binding protein	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0361: Maltose/maltodextrin transport ATP-binding protein	Maltose/maltodextrin transport ATP-binding protein
malA	Staphylococcus aureus subsp. aureus N315 Gene: SA1338: Alpha-glucosidase (EC 3.2.1.20)	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435 Gene: SH1408: Alpha-glucosidase (EC 3.2.1.20)	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP1246: Alpha-glucosidase (EC 3.2.1.20)	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0362: Alpha-glucosidase (EC 3.2.1.20)	Alpha-glucosidase (EC 3.2.1.20)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MalR - Staphylococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --