Regulog MalR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 9 | 2 |
| Staphylococcus capitis SK14 | ||
| Staphylococcus epidermidis ATCC 12228 | ||
| Staphylococcus carnosus subsp. carnosus TM300 | ||
| Staphylococcus haemolyticus JCSC1435 | 2 | 1 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 2 | 1 |
| Macrococcus caseolyticus JCSC5402 | 10 | 1 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| mdxE |
Gene: SA0207: Maltose/maltodextrin ABC transporter, substrate binding protein |
|
|
|
|
|
*
Macrococcus caseolyticus JCSC5402 Site: position = -110 score = 6.66683 sequence = TTATGCAATCGTTTGCAAAA Gene: MCCL_0353: Maltose/maltodextrin ABC transporter, substrate binding protein |
Maltose/maltodextrin ABC transporter, substrate binding protein |
| mdxF |
Gene: SA0208: Maltose/maltodextrin ABC transporter, permease protein |
|
|
|
|
|
Gene: MCCL_0354: Maltose/maltodextrin ABC transporter, permease protein |
Maltose/maltodextrin ABC transporter, permease protein |
| mdxG |
Gene: SA0209: Maltose/maltodextrin ABC transporter, permease protein |
|
|
|
|
|
Gene: MCCL_0355: Maltose/maltodextrin ABC transporter, permease protein |
Maltose/maltodextrin ABC transporter, permease protein |
| malR |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -112 score = 6.90263 sequence = TTATGCAATCGTTTGCACAA Gene: SA1339: Maltose operon transcriptional repressor MalR, LacI family |
|
|
|
*
Staphylococcus haemolyticus JCSC1435 Site: position = -228 score = 6.55203 sequence = TTATGCAAACGATTGCATTA Gene: SH1407: Maltose operon transcriptional repressor MalR, LacI family |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -106 score = 6.42784 sequence = TCGCGCAAACGTTTGCACAA Gene: SSP1245: Maltose operon transcriptional repressor MalR, LacI family |
Gene: MCCL_0356: Maltose operon transcriptional repressor MalR, LacI family |
Maltose operon transcriptional repressor MalR, LacI family |
| MCCL_0357 |
|
|
|
|
|
|
Gene: MCCL_0357: trehalosemaltose utilization protein |
trehalosemaltose utilization protein |
| gfoA |
Gene: SA0210: putative glucose dehydrogenase A |
|
|
|
|
|
Gene: MCCL_0358: putative glucose dehydrogenase A |
putative glucose dehydrogenase A |
| gfoB |
Gene: SA0211: putative glucose dehydrogenase B |
|
|
|
|
|
Gene: MCCL_0359: putative glucose dehydrogenase B |
putative glucose dehydrogenase B |
| gfoI |
Gene: SA0212: putative sugar isomerase |
|
|
|
|
|
Gene: MCCL_0360: putative sugar isomerase |
putative sugar isomerase |
| mdxK |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -66 score = 6.74219 sequence = TTGTGCAAACGTTTTCACAA Gene: SA0206: Maltose/maltodextrin transport ATP-binding protein |
|
|
|
|
|
Gene: MCCL_0361: Maltose/maltodextrin transport ATP-binding protein |
Maltose/maltodextrin transport ATP-binding protein |
| malA |
Gene: SA1338: Alpha-glucosidase (EC 3.2.1.20) |
|
|
|
Gene: SH1408: Alpha-glucosidase (EC 3.2.1.20) |
Gene: SSP1246: Alpha-glucosidase (EC 3.2.1.20) |
Gene: MCCL_0362: Alpha-glucosidase (EC 3.2.1.20) |
Alpha-glucosidase (EC 3.2.1.20) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |