Regulon of MalR in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_0356
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Staphylococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -110 Score: 6.7 Sequence: TTATGCAATCGTTTGCAAAA Locus tag: MCCL_0353 Name: mdxE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein Locus tag: MCCL_0354 Name: mdxF Funciton: Maltose/maltodextrin ABC transporter, permease protein Locus tag: MCCL_0355 Name: mdxG Funciton: Maltose/maltodextrin ABC transporter, permease protein Locus tag: MCCL_0356 Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family Locus tag: MCCL_0357 Name: MCCL_0357 Funciton: trehalosemaltose utilization protein Locus tag: MCCL_0358 Name: gfoA Funciton: putative glucose dehydrogenase A Locus tag: MCCL_0359 Name: gfoB Funciton: putative glucose dehydrogenase B Locus tag: MCCL_0360 Name: gfoI Funciton: putative sugar isomerase Locus tag: MCCL_0361 Name: mdxK Funciton: Maltose/maltodextrin transport ATP-binding protein Locus tag: MCCL_0362 Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	MCCL_0353	mdxE	Maltose/maltodextrin ABC transporter, substrate binding protein
	MCCL_0354	mdxF	Maltose/maltodextrin ABC transporter, permease protein
	MCCL_0355	mdxG	Maltose/maltodextrin ABC transporter, permease protein
	MCCL_0356	malR	Maltose operon transcriptional repressor MalR, LacI family
	MCCL_0357	MCCL_0357	trehalosemaltose utilization protein
	MCCL_0358	gfoA	putative glucose dehydrogenase A
	MCCL_0359	gfoB	putative glucose dehydrogenase B
	MCCL_0360	gfoI	putative sugar isomerase
	MCCL_0361	mdxK	Maltose/maltodextrin transport ATP-binding protein
	MCCL_0362	malA	Alpha-glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD