Regulon of MalR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type:	Transcription factor
TF locus tag:	SA1339
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Staphylococcaceae
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -112 Score: 6.9 Sequence: TTATGCAATCGTTTGCACAA Locus tag: SA1339 Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family Locus tag: SA1338 Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	SA1339	malR	Maltose operon transcriptional repressor MalR, LacI family
	SA1338	malA	Alpha-glucosidase (EC 3.2.1.20)
Position: -66 Score: 6.7 Sequence: TTGTGCAAACGTTTTCACAA Locus tag: SA0206 Name: mdxK Funciton: Maltose/maltodextrin transport ATP-binding protein Locus tag: SA0207 Name: mdxE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein Locus tag: SA0208 Name: mdxF Funciton: Maltose/maltodextrin ABC transporter, permease protein Locus tag: SA0209 Name: mdxG Funciton: Maltose/maltodextrin ABC transporter, permease protein Locus tag: SA0210 Name: gfoA Funciton: putative glucose dehydrogenase A Locus tag: SA0211 Name: gfoB Funciton: putative glucose dehydrogenase B Locus tag: SA0212 Name: gfoI Funciton: putative sugar isomerase
	SA0206	mdxK	Maltose/maltodextrin transport ATP-binding protein
	SA0207	mdxE	Maltose/maltodextrin ABC transporter, substrate binding protein
	SA0208	mdxF	Maltose/maltodextrin ABC transporter, permease protein
	SA0209	mdxG	Maltose/maltodextrin ABC transporter, permease protein
	SA0210	gfoA	putative glucose dehydrogenase A
	SA0211	gfoB	putative glucose dehydrogenase B
	SA0212	gfoI	putative sugar isomerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD