Regulon of MalR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP1245
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Staphylococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 6.4 Sequence: TCGCGCAAACGTTTGCACAA Locus tag: SSP1245 Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family Locus tag: SSP1246 Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	SSP1245	malR	Maltose operon transcriptional repressor MalR, LacI family
	SSP1246	malA	Alpha-glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD