Regulon of MalR in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH1407
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Staphylococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -228 Score: 6.6 Sequence: TTATGCAAACGATTGCATTA Locus tag: SH1407 Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family Locus tag: SH1408 Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	SH1407	malR	Maltose operon transcriptional repressor MalR, LacI family
	SH1408	malA	Alpha-glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD