Regulog PtsR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 3 | 2 |
| Bifidobacterium adolescentis ATCC 15703 | 1 | 1 |
| Bifidobacterium angulatum DSM 20098 | 2 | 2 |
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | 3 | 2 |
| Bifidobacterium breve DSM 20213 | 3 | 2 |
| Bifidobacterium dentium Bd1 | 3 | 2 |
| Bifidobacterium gallicum DSM 20093 | 2 | 2 |
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| hpr |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -112 score = 5.85099 sequence = AACGGTAATCGTTTTCTGGA Gene: Blon_0177: Phosphotransferase system, phosphocarrier HPr protein |
|
*
Bifidobacterium angulatum DSM 20098 Site: position = -116 score = 6.09672 sequence = AACAGTAAACGTTTTCCGTG Gene: BIFANG_00109: Phosphotransferase system, phosphocarrier HPr protein |
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -214 score = 5.31632 sequence = AGAAGTAAACGTTTTCCAGA Gene: BbifN4_010100006903: Phosphotransferase system, phosphocarrier HPr protein |
*
Bifidobacterium breve DSM 20213 Site: position = -74 score = 5.85099 sequence = AACGGTAATCGTTTTCTGGA Gene: BIFBRE_01976: Phosphotransferase system, phosphocarrier HPr protein |
*
Bifidobacterium dentium Bd1 Site: position = -130 score = 5.76935 sequence = AAAGGAAAACGTTTTCTGCG Gene: BDP_0253: Phosphotransferase system, phosphocarrier HPr protein |
*
Bifidobacterium gallicum DSM 20093 Site: position = -234 score = 5.40572 sequence = AGCGGTAATCGTTTTCTAGG Gene: BIFGAL_00155: Phosphotransferase system, phosphocarrier HPr protein |
|
Gene: HMPREF0424_1269: Phosphotransferase system, phosphocarrier HPr protein |
Phosphotransferase system, phosphocarrier HPr protein |
| ptsR |
Gene: Blon_0176: Transcriptional regulator of general components of PTS, LacI family |
Gene: BAD_0164: Transcriptional regulator of general components of PTS, LacI family |
Gene: BIFANG_00110: Transcriptional regulator of general components of PTS, LacI family |
|
Gene: BbifN4_010100006898: Transcriptional regulator of general components of PTS, LacI family |
Gene: BIFBRE_01975: Transcriptional regulator of general components of PTS, LacI family |
Gene: BDP_0252: Transcriptional regulator of general components of PTS, LacI family |
Gene: BIFGAL_00153: Transcriptional regulator of general components of PTS, LacI family |
|
|
Transcriptional regulator of general components of PTS, LacI family |
| CRON 2. | |||||||||||
| ptsI |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -164 score = 5.85099 sequence = TCCAGAAAACGATTACCGTT Gene: Blon_0178: PTS system, enzyme I |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -138 score = 6.04849 sequence = CACAGAAAACGTTTACCGGT Gene: BAD_0166: PTS system, enzyme I |
*
Bifidobacterium angulatum DSM 20098 Site: position = -185 score = 6.09672 sequence = CACGGAAAACGTTTACTGTT Gene: BIFANG_00108: PTS system, enzyme I |
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -162 score = 5.31632 sequence = TCTGGAAAACGTTTACTTCT Gene: BbifN4_010100006908: PTS system, enzyme I |
*
Bifidobacterium breve DSM 20213 Site: position = -164 score = 5.85099 sequence = TCCAGAAAACGATTACCGTT Gene: BIFBRE_01978: PTS system, enzyme I |
*
Bifidobacterium dentium Bd1 Site: position = -174 score = 5.76935 sequence = CGCAGAAAACGTTTTCCTTT Gene: BDP_0254: PTS system, enzyme I |
*
Bifidobacterium gallicum DSM 20093 Site: position = -255 score = 5.40572 sequence = CCTAGAAAACGATTACCGCT Gene: BIFGAL_00157: PTS system, enzyme I |
|
Gene: HMPREF0424_1268: PTS system, enzyme I |
PTS system, enzyme I |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |