Regulon of PtsR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_0252
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	PtsR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -174 Score: 5.8 Sequence: CGCAGAAAACGTTTTCCTTT Locus tag: BDP_0254 Name: ptsI Funciton: PTS system, enzyme I
	BDP_0254	ptsI	PTS system, enzyme I
Position: -130 Score: 5.8 Sequence: AAAGGAAAACGTTTTCTGCG Locus tag: BDP_0253 Name: hpr Funciton: Phosphotransferase system, phosphocarrier HPr protein Locus tag: BDP_0252 Name: ptsR Funciton: Transcriptional regulator of general components of PTS, LacI family
	BDP_0253	hpr	Phosphotransferase system, phosphocarrier HPr protein
	BDP_0252	ptsR	Transcriptional regulator of general components of PTS, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD