Regulon of PtsR in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type:	Transcription factor
TF locus tag:	BbifN4_010100006898
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	PtsR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -162 Score: 5.3 Sequence: TCTGGAAAACGTTTACTTCT Locus tag: BbifN4_010100006908 Name: ptsI Funciton: PTS system, enzyme I
	BbifN4_010100006908	ptsI	PTS system, enzyme I
Position: -214 Score: 5.3 Sequence: AGAAGTAAACGTTTTCCAGA Locus tag: BbifN4_010100006903 Name: hpr Funciton: Phosphotransferase system, phosphocarrier HPr protein Locus tag: BbifN4_010100006898 Name: ptsR Funciton: Transcriptional regulator of general components of PTS, LacI family
	BbifN4_010100006903	hpr	Phosphotransferase system, phosphocarrier HPr protein
	BbifN4_010100006898	ptsR	Transcriptional regulator of general components of PTS, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD